SciELO - Scientific Electronic Library Online

 
vol.60 número231 índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Archivos de Zootecnia

versión impresa ISSN 0004-0592

Arch. zootec. vol.60 no.231 Córdoba set. 2011

http://dx.doi.org/10.4321/S0004-05922011000300041 

 

Variantes en dos genes candidatos para características de calidad de carne bovina en Argentina

Polymorphisms in two candidate genes for beef quality in Argentina

 

 

Branda Sica, A.1*,Soria, L.A.2, Corva, P.M.3, Villarreal, E.L.4, Melucci, L.M.3, Mezzadra, C.A.4, Schor, A.5 y Miquel, M.C.2

1Unidad de Biotecnología. INIA. Las Brujas. Uruguay
2Facultad de Ciencias Veterinarias. Universidad de Buenos Aires. Argentina
3Facultad de Ciencias Agrarias. Universidad Nacional de Mar del Plata. Balcarce. Argentina
4Instituto Nacional de Tecnología Agropecuaria. Balcarce. Argentina
5Facultad de Agronomía. Universidad de Buenos Aires. Argentina

Este trabajo fue financiado por la Agencia Nacional de Promoción Científica y Tecnológica de Argentina. Los novillos fueron provistos por el Instituto Nacional de Tecnología Agropecuaria (INTA) y por socios de la Asociación Argentina de Brangus

 

 


RESUMEN

La calidad de la carne bovina está definida por muchos atributos. Está determinada por factores genéticos y ambientales (edad al sacrificio, alimentación, manejo anterior y posterior a la faena). La tendencia actual es estudiar genes candidatos con el propósito de desarrollar marcadores moleculares que puedan asistir a la selección. El objetivo de este trabajo fue evaluar el efecto de polimorfismos (SNP, single nucleotide polymorphisms) en genes candidatos para terneza y contenido de grasa en novillos engordados en condiciones de pastoreo de Argentina. Se diseñaron métodos moleculares para analizar el SNP 4751 (C/T) en el gen bovinocapn1 (subunidad mayor de la μ-calpaína), asociado con terneza y dos polimorfismos (exón 8:G/A, e intrón 9:C/T) en el gen bovino ppargc1a (coactivador 1 alfa del receptor gamma activado por proliferadores peroxisómicos) con efecto sobre contenido de grasa en leche bovina y tipo de fibra en cerdos. Para los análisis de asociación se utilizaron 60 novillos Brangus y 21 Angus con registros de terneza y grasa intramuscular. La terneza (Resistencia al Corte- por Cizalla de Warner-Bratzler) fue determinada en tres tratamientos de maduración (1, 7 y 14 días). Una gran proporción de animales heterocigotos (CT) se observó en el SNP 4751. No se encontró ninguna diferencia entre los genotipos de ese SNP para RC (Resistencia al Corte determinada por Cizalla de Warner-Bratzler).
En el SNP del intrón 9 del gen ppargc1a se halló una baja frecuencia de homocigotos TT. No se encontraron diferencias en grasa intramuscular ni en terneza entre los genotipos para dicho SNP. Se identificaron dos nuevos polimorfismos (G/Ay C/T) en el exón 8 del gen ppargc1a, a partir de la comparación de secuencias obtenidas de 24 toros de razas distintas (Angus, Brangus, Brahman y Braford). Uno de ellos (G/A) podría provocar la sustitución de serina por asparragina en la posición 364 de la proteína. El alelo A no se encontró en Angus. El SNPC/T es una sustitución conservativa. Es importante que Argentina genere información sobre este tema para optimizar la producción y exportación de carnes de calidad.

Palabras clave: Terneza de la carne. Contenido de grasa. Marcadores moleculares. SNP. capn1. ppargc1a.


SUMMARY

Meat quality is a term used to describe a range of attributes of meat. It is determined by genetic and environmental factors (slaughter age, feeding and pre and post-slaughter management). The current tendency is to study the candidate genes in order to develop molecular markers, which might be used for marker-assisted selection. The objective of this work was to evaluate the effect of polymorphisms (SNP, single nucleotide polymorphisms) in candidate genes for tenderness and fat content in steers fattened in grazing beef production systems of Argentina. Molecular methods were designed to analyze the SNP 4751 (C/T) in bovine capn1 gene (large subunit of μcalpain), associated with tenderness and two polymorphisms (exon 8:G/A and intron 9:C/T) in bovine ppargc1a gene (peroxisome proliferatoractivated receptor gamma coactivator 1-alpha) with effect on fat content in cow milk and fiber type in pigs. Information of Warner-Bratzler shear force and fat content from 60 Brangus and 21 Angus steers was used in association studies. Tenderness of cooked meat was evaluated at 1.7 and 14 days post-mortem. A large proportion of animals were heterozygotes (CT) at SNP 4751. No differences were found between genotypes of this SNP for WBSF. A low frequency of homozygote TT was found at SNP on intron 9 of the ppargc1a gene. This SNP showed no significant effect on WBSF and fat content. Two new SNPs (G/A and T/C) were identified within exon 8 of the ppargc1a gene, by multiple alignment of DNA sequences obtained from 24 bulls of different breeds (Angus, Brangus, Brahman and Braford). One of them (G/ A) could be the cause of aminoacid substitution of serine by asparagine at position 364 of the protein. The A allele was not found in Angus. The SNP T/ C is a conservative substitution. It is important that Argentina generate information about factors affecting meat quality for optimizing the production and exportation of high quality beef.

Key words: Meat tenderness. Fat content. Molecular markers. SNP. capn1. ppargc1a.


 

Introducción

La calidad de la carne bovina está determinada por varios atributos, entre los cuales se destacan la composición corporal (por ejemplo: proporción de grasa en la res), la calidad tecnológica (aptitud de la carne para su consumo, conservación o transformación), la calidad nutricional (contenido de elementos que responden a las necesidades del consumidor, cantidad de grasa y su composición), y la seguridad alimentaria. De todos ellos, uno de los más valorado y exigido es la terneza (Miller, 1992; Boleman et al., 1997).

Muchos son los factores descriptos en la bibliografía involucrados con la determinación de la terneza. Los cuatro principales son: la fragmentación post-mortem de la fibra muscular, la cantidad y el tipo de tejido conectivo, principalmente el colágeno, y la cantidad de grasa intramuscular o marmoleado (Barton-Gade, 1988). Las causas que los determinan pueden ser genéticas y ambientales (edad, sexo, alimentación, y manejo pre y post-faena). La composición química y estructura del músculo son factores importantes en su determinación y éstos varían entre razas. La variación en la terneza de la carne entre razas ha sido reportada por Marshall (1999) y Burrow et al. (2001). Los caracteres que determinan la calidad de la carne son mayoritariamente de herencia cuantitativa, eso significa que actúan en su determinación muchos genes con efecto individual pequeño. Además, el ambiente influye sobre ellas de manera importante. La mayoría son difíciles de medir y requieren el sacrifico del animal, además su medición es costosa y se realiza a edad adulta. Todas estas particularidades determinan que habitualmente no se los incluya en los programas de mejoramiento genético, a pesar de su importancia económica.

La tendencia actual es estudiar los genes que por su función o posición en el genoma, podrían tener efecto en su determinación, con el propósito de desarrollar marcadores moleculares que podrían asistir a la selección. Sobre la base de la información consultada y presentada se destaca la importancia de dos genes candidatos por su localización en regiones del genoma en donde existen QTL (quantitative trait loci) y su potencial función en los procesos metabólicos involucrados en las características en estudio. En ambos se han descripto SNPs con efecto sobre atributos de importancia económica. En este sentido, el gencapn1 (subunidad mayor de la μ-calpaína) ha sido asociado con terneza (Smith et al., 2000; Page et al., 2002, 2004) y el gen ppargc1a (coactivador 1 alfa del remorceptor gamma activado por proliferadores peroxisómicos) con efecto sobre contenido de grasa en leche bovina (Weikard et al., 2005) y tipo de fibra en cerdos (Jacobs et al., 2006). El SNP 4751 del gen capn1 se halló asociado con la resistencia al corte (RC) a los 14 días postmortem en novillos Brahman y cruzas de Bos indicus x Bos taurus (White et al., 2005). En el caso del gen ppargc1a, la información disponible en bovinos para carne es muy escasa y en la bibliografía consultada, un solo trabajo analiza el efecto del SNP localizado en el intrón 9 sobre la terneza (White et al., 2007).

En este trabajo se pretende investigar la presencia de polimorfismos en ambos genes analizados, la existencia de variabilidad en cada SNP y el efecto de los mismos sobre los atributos de calidad de carne.

 

Materiales y métodos

ANIMALES Y DATOS FENOTÍPICOS

Para la búsqueda de polimorfismos nuevos en el gen ppargc1a, se utilizaron 24 toros de cuatro razas distintas: 7 Angus, 9 Brangus, 2 Braford y 6 Brahman. Todos no relacionados y de uso en inseminación artificial.

Para determinar el efecto de los SNPs seleccionados sobre terneza y/o contenido de grasa, se utilizaron 21 novillos Angus y 60 novillos Brangus, engordados en condiciones extensivas. Los Angus pertenecían a dos stocks diferentes de la Estación Experimental INTA Balcarce. Los denominados A7 (Angus INTA) pertenecen al rodeo original de dicha estación, el cual no ha sido sometido a selección por crecimiento. El otro grupo (A6) pertenece a un rodeo de vacas de INTA y toros Angus comerciales. Los novillos Brangus fueron aportados por tres cabañas miembro de la Asociación Argentina de Brangus. Estos animales fueron identificados como grupo: BR1, BR2 y BR3, de acuerdo al origen. Los 81 novillos fueron engordados durante el período comprendido entre abril de 2004 y mayo de 2005 en la reserva 7 de la Unidad Integrada Balcarce (Balcarce, Buenos Aires). El engorde se realizó sobre pasturas polifíticas y los animales fueron faenados cuando más del 50% del grupo genético alcanzó un espesor de grasa dorsal promedio de 6 mm, determinada in vivo por ultrasonografía. Durante todo ese período se realizaron mediciones mensuales de peso vivo (PV) y espesor de grasa dorsal (EGD). En la tabla I se resumen los promedios correspondientes a cada grupo genético.

 

 

Después de la faena, se removieron tres bifes a la altura de la 11a, 12ay 13acostilla (músculo Longissimus lumborum). Cada uno de ellos se sometió a un período de maduración diferente (1, 7 y 14 días) a 4oC asignados al azar a los sitios. Luego se conservaron en congelador (-20oC) hasta su envío al laboratorio de carnes en la Facultad de Agronomía (Universidad de Buenos Aires), en donde se hicieron las determinaciones de terneza según Corva et al., 2007 y contenido de grasa intramuscular (GIM) según el protocolo 920.39 de AOAC (1992).

AISLAMIENTO DE ADN GENÓMICOTOTAL

En toros, se extrajo el ADN desde pajuela o pastilla de semen con fenol/cloroformo y posterior precipitación con etanol, utilizando un buffer de lavado (3M NaCl; 1M Tris; 0,5M Na2-EDTA) y otro de digestión, este último adaptado (3M NaCl 1M Tris; 0,05M Na2-EDTA; 20% SDS; 0,1M de ditiotreitol y 20 mg/ml de proteinasa K).

En novillos, se aisló el ADN a partir de 500 μl de sangre por extracción con fenol/ cloroformo y precipitación con etanol (Sambrook et al., 1989).

El ADN aislado a partir de sangre y semen fue resuspendido en Tris HCl 10 mM (pH= 8,0).

Para el control de su calidad, se realizó un gel de agarosa al 0,8% en TBE 0,5X (0,045M Tris borato; 0,01M Na2-EDTA) teñido con bromuro de etidio (10 mg/ml, Sigma-Aldrich, St. Louis, MO, EE.UU.). Las corridas electroforéticas se realizaron a 80 V durante 45 min. Los geles fueron observados en un transiluminador de luz ultravioleta (Foto/UV 300 transilluminator, Fotodyne, Hartland, WI, EE.UU.) y fotografiados con cámara digital (Nikon Coolpix 950, Tokyo, Japón). Las imágenes fueron transferidas a una computadora y analizadas mediante el programa Adobe Photoshop 5.0.

Para determinar su concentración, se realizó la cuantificación de las muestras en un espectrofotómetro (GeneQuant, GE Healthcare, Little Chalfont, Reino Unido). Se utilizó una dilución 1:100 de cada muestra y se determinó la absorbancia de las mismas en dos longitudes de onda: 260 nm y 280 nm.

BÚSQUEDA DE POLIMORFISMOS EN EL GEN PPARGC1A

Para la identificación de polimorfismos en este gen, se realizó el análisis y alineamiento de 29 secuencias de ARNm y ESTs recopiladas de GenBank (disponibles al 26/ 04/06), mediante programas disponibles en Internet. No se pudo seleccionar ninguno porque los hallados mostraron un bajo nivel de redundancia. Por este motivo, se decidió analizar las secuencias de los 24 toros de cuatro razas distintas mediante PCR y posterior secuenciación para buscar polimorfismos nuevos. Para amplificar determinadas regiones de dicho gen se definieron los límites de cada exón en la secuencia de ARNm bovino publicada (número de acceso al GenBank AY321517). Dicha organización se hizo a partir del alineamiento entre dicha secuencia y las 13 secuencias genómicas del cerdo disponibles en GenBank (AY484494 al AY484502). Se decidió amplificar y secuenciar los exones 3, 5, 8 y la región 3' no codificante (NT). La elección de estas regiones del gen se hizo teniendo en cuenta lo siguiente: (1) tamaño de los exones (a mayor tamaño mayor probabilidad de identificar SNP y de obtener secuencias de calidad), (2) estos exones codifican aminoácidos que corresponden a dominios de interacción, y (3) la región 3' no codificante es una región que acumula muchas mutaciones en general en todos los genes y tiene función reguladora.

Se utilizaron para cada región analizada, un par de cebadores para PCR y otro cebador directo interno para secuenciar, todos seleccionados mediante el programa Oligo 4.0 (Molecular Biology Insights, Cascade, CO, EE.UU.). Los cebadores utilizados y los tamaños de los productos de PCR respectivos se muestran en la tabla II.

 

 

Para reducir el número de secuencias de ADN a analizar en el secuenciador automático, se prepararon grupos de productos de PCR obtenidos de toros de la misma raza. Se analizaron 7 toros Angus agrupados en 3 grupos, 6 Brahman agrupados en 2 grupos, 9 Brangus agrupados en 3 grupos y 2 Braford agrupados en 1 grupo.

Las condiciones de PCR para obtener el fragmento de cada región del gen de los toros utilizados se indican en la tabla II. Las reacciones se realizaron en un volumen final de 25 μl, conteniendo 100-180 ng de ADN genómico, 25 pmoles de cada cebador, MgCl2, 200 μM de dNTPs (Promega, Madison, WI, EE.UU.), Buffer 10X y 2 U de Taq polimerasa (Invitrogen, Carlsbad, CA, EE.UU.). El programa de PCR utilizado consistió en 4 min a 95oC, 30 ciclos de 1 min de desnaturalización a 95oC, 1 min de hibridación a la temperatura apropiada para cada fragmento y 1 min de extensión a 72oC cada uno, y una extensión final a 72oC durante 4 min.

Los productos de PCR controlados y de tamaño esperado fueron purificados desde geles de agarosa mediante columnas GFX para purificación de ADN (GE Healthcare, Little Chalfont, Reino Unido), y fueron enviadas al Servicio de Secuenciación y Genotipado USFCEyN (Unidad de Secuenciación de la Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires) con los cebadores directos internos correspondientes a cada exón (3, 5 y 8) y a la región 3' no traducida. Los cebadores utilizados para la secuenciación fueron (5'a 3'): Exón 3: GCAGTCCTCACAGAGACACTGG, Exón 5: CAACAGCAAAAGCCACAAAGAC, Exón 8: TTCTCCAAAGCTGAAGCCCTC, Extremo 3' no traducido: TGAAGAGGCAAGAGACAGAATG.

Posteriormente, se realizó el análisis de las secuencias obtenidas mediante el programa BioEdit (http://www.mbio.ncsu.edu/BioEdit/BioEdit.html) para establecer la similitud entre ellas, con el propósito de identificar SNPs nuevos.

DETERMINACIÓN DE GENOTIPOS PARA LOS GENES CAAPN1 Y PPARGC1A

El SNP (alelos A y G) identificado en el exón 8 del gen ppargc1a por comparación de secuencias obtenidas de los toros utilizados se analizó para determinar su potencial asociación con atributos de calidad de carne. Con este propósito, se diseñó un método de PCR-RFLP con las condiciones de reacción optimizadas en un volumen final de 25 μl, conteniendo 100-180 ng de ADN, 2 mM MgCl2, 200 μM de dNTPs, Buffer 10X y 2 U deTaq polimerasa, utilizando un cebador directo mutado (sustitución de C por G) para crear un sitio de corte para la enzima BtsI con sitio de reconocimiento GCAGTG‘NN, para genotipar la muestra en estudio. Se seleccionó un par de cebadores capaz de generar un producto de PCR de 255 pb (tabla III). El programa de PCR utilizado consistió en 4 min a 95oC, 30 ciclos de 45 s de desnaturalización a 95oC, 1 min de hibridación a 63oC y 45 s de extensión a 72oC cada uno, y una extensión final a 72oC durante 4 min.

También se analizó el SNP del intrón 9 de dicho gen mediante la técnica de PCR-RFLP, utilizando los cebadores descriptos por Weikard et al., 2005. Se ajustaron las condiciones de reacción en un volumen final de 50 μl, conteniendo 100-180 ng de ADN genómico, 200μM de dNTPs, 1,5 mM MgCl2, Buffer 10X y 2 U de Taq polimerasa, para obtener el producto esperado de 178 pb (tabla III). El cebador directo presenta un nucleótido sustituido (C por G) en forma deliberada (mismatch) para crear un sitio de corte para la enzima HaeIII con sitio de reconocimiento C'CNNG'G, que permite discriminar los alelos T yC. El programa de PCR utilizado consistió en 5 min a 94oC, 30 ciclos de 45 s de desnaturalización a 94oC, 1 min de hibridación a 61oC y 45 s de extensión a 72oC cada uno, y una extensión final a 72oC durante 4 min.

 

 

Para discriminar los alelos C y T del SNP 4751 del gencapn1 localizado en el intrón 17 (White et al., 2005), se diseñaron dos métodos: ARMS-PCR y PCR-RFLP. Para la técnica ARMS-PCR, se seleccionó un par de cebadores externos directo y reverso, y otro par de internos directo y reverso (tabla III). La elección se realizó a partir de un fragmento de 564 pares de bases correspondientes a los exones 17 y 18 del gen capn1, que incluía el intrón 17 donde se localiza el SNP 4751 mediante el programa disponible en http://cedar.genetics.soton.ac.uk/public_html/primer1.html.

La reacción de ARMS-PCR se realizó en un volumen total de 15 μl, conteniendo 4060 ng de ADN, dos pares de cebadores internos y externos (tabla III), 200 μM de dNTPs, 3,5 mM MgCl2, Buffer 10X y 1 U de Taq polimerasa. El programa de PCR utilizado fue de 4 min a 95oC, seguido por 35 ciclos, de los cuales los 7 primeros consisten en 45 s de desnaturalización a 95oC y 45 s de hibridación partiendo de una temperatura de 81oC para el primer ciclo y bajando 1oC por cada ciclo hasta llegar a 72oC y 45 s de extensión a 72oC. Los 25 ciclos restantes con las mismas condiciones, pero con una temperatura de hibridación constante a 72oC. Al final de los 35 ciclos, una extensión final a 72oC durante 1 min.

Previo al genotipado de todas las muestras, se utilizó la técnica de PCR-RFLP como control. El producto de 215 pares de bases, obtenido por PCR con los cebadores externos (tabla III) utilizados en la técnica de ARMS-PCR, de animales con genotipos distintos de acuerdo al test (CC, CT y TT), fueron digeridos con la enzima BsaJI. Las reacciones de PCR se realizaron en un volumen final de 25 μl, conteniendo 100-180 ng de ADN genómico, 200 μM de dNTPs, 1,5 MgCl2, Buffer 10X y 2 U de Taq polimerasa. El programa de PCR utilizado consistió en 4 min a 95oC, 30 ciclos de 1 min de desnaturalización a 95oC, 1 min de hibridación a 74oC y 1 min de extensión a 72oC cada uno, y una extensión final a 72oC durante 4 min.

Para cada uno de los tres SNPs analizados, el producto de PCR fue digerido con 2 U de enzima de restricción (New England Biolabs, Beverly, MA, EE.UU.) según las condiciones indicadas en la tabla III. Los fragmentos del producto digerido fueron analizados mediante electroforesis en geles de agarosa al 2% en TBE 0,5X a70 voltios durante 1 hora y 20 minutos teñidos con bromuro de etidio, observados en transiluminador UV y fotografiados con cámara digital.

ANÁLISIS ESTADÍSTICO

El modelo utilizado para determinar la influencia de los genotipos del SNP 4751 sobre RC incluyó los efectos del genotipo para este marcador, grupo genético, tratamiento (RC a 1,7 y 14 días), sitio y tratamiento por grupo genético. Se utilizó el procedimiento PROC MIXED del programa SAS (SAS, Cary, NC, EE.UU.) para este análisis tomando animal como efecto aleatorio.

Con el dato de grasa intramuscular obtenido del corte con 1 día de maduración se determinó el efecto del SNP del intrón 9 del gen ppargc1a sobre dicho atributo.

El modelo utilizado incluyó grupo genético y genotipo del SNP. Se utilizó el procedimiento GLM del programa SAS para este análisis.

 

Resultados y discusión

FRECUENCIAS GENOTÍPICAS Y ALÉLICAS DEL SNP 4751 DEL GEN CAPN1

Se observó una alta frecuencia de heterocigotos (CT) excepto en el grupo A7 en el SNP 4751 del gen capn1 (tabla IV). El alelo C ha sido considerado el más favorable para la terneza de la carne (White et al., 2005). Las frecuencias halladas en este trabajo se asemejan a las informadas por White et al. (2005), quienes utilizaron novillos de distintas razas y cruzas, entre ellas Brangus. Para este marcador vale la pena destacar que las frecuencias calculadas sobre el total de animales analizados (sin discriminar por grupo genético) presentan valores intermedios (0,37 para T y 0,63 para C), eso significa que ningún alelo está fijado. El alelo C fue más frecuente en el grupo A7, BR2 y BR3, y el alelo T en el grupo BR1.

 

 

EFECTO DEL MARCADOR CAPN 4751 SOBRE LA TERNEZA

No se encontró ninguna diferencia entre los genotipos de este SNP en la RC (p>0,05) de cada muestra de carne con maduración de 1, 7 y 14 días (tabla V). Solo el tratamiento y el grupo genético tuvieron efecto sobre la terneza (p<0,05) y no se observó efecto del SNP 4751 sobre RC (p= 0,57) (tabla VI). Tampoco se observó una tendencia hacia una acción aditiva del gen en ninguno de los tres tratamientos (datos no mostrados).

 

 

 

En 481 novillos Brahman, White et al. (2005) hallaron una diferencia significativa (0,4 kg) entre el genotipo más tierno (CT) y el menos tierno (TT), en carnes con 14 días de maduración (p<0,015). En tanto que en ganado cruza Bos indicus x Bos taurus el resultado fue semejante, aunque con una diferencia menor entre ambos genotipos homocigotos (0,24 kg). Sobre la base de este resultado dicho SNP se consideró útil en ambas subespecies, lo que no pudo ser confirmado en esta muestra de 60 novillos Brangus engordados en las condiciones de la Argentina.

FRECUENCIAS GENOTÍPICAS Y ALÉLICAS DEL SNP DEL INTRÓN 9 DEL GEN PPARGC1A

En dicho SNP, se halló un escaso número de homocigotos TT (tabla VII). El alelo C resultó más frecuente en el total de animales analizados, con frecuencia máxima (0,95) en el grupo BR1 y el mínimo (0,72) en A7.

 

 

Weikard et al. (2005) encontraron diferencias significativas en el contenido de grasa en la leche en una población Holstein originados de vacas altamente seleccionadas para rasgos de producción de leche y una población control de la misma raza en dicho SNP. Las frecuencias halladas del alelo C fueron superiores a 0,8.

White et al. (2007) analizaron este SNP en ganado de carne en el Banco de Germoplasma delClay Center, hallando al alelo T fue el menos frecuente (en B. taurus 0,15 y en cruzas con B. indicus 0,17). Esto significa que el alelo T tiene baja frecuencia en general, más allá de la raza y el origen.

EFECTO DEL SNP DEL INTRÓN 9 DEL GEN PPARGC1A SOBRE CONTENIDO DE GRASA

Se destaca el efecto del grupo genético sobre el contenido de grasa intramuscular (p<0,05), pero no se detectó efecto de ese SNP sobre ese carácter (p>0,05)(tabla VIII). Se obtuvieron promedios muy semejantes entre genotipos (CC= 2,92, CT= 2,64 y TT= 2,81) y el valor del heterocigoto no fue intermedio.

 

 

Sin embargo, hay que destacar que el coeficiente de variación fue demasiado alto (38,35%). El número reducido de datos y la variación de los mismos podría ser una de las razones que explica que no haya habido diferencias entre los genotipos del SNP del intrón 9 para grasa intramuscular ni para terneza (p>0,05) (tabla IX). No obstante, este resultado coincide con lo informado por White et al. (2007) en novillos B. taurus y novillos B. taurus x B. indicus, pero utilizando más de 500 novillos en cada caso.

 

 

BÚSQUEDA DE NUEVOS POLIMORFISMOS EN EL GEN PPARGC1A

Se delimitó cada exón de dicho gen (tabla X), el tamaño de cada uno coincidió con lo informado por Weikard et al. (2005).

 

 

Se identificaron nuevos polimorfismos en el exón 8 de este gen, a partir del alineamiento múltiple de 9 secuencias obtenidas de 24 toros de cuatro razas distintas (Angus, Brangus, Brahman y Braford). Uno de ellos (G/A) provocaría la sustitución de serina por asparragina en la posición 364 de la proteína (figura 1). Esta sustitución podría provocar cambios funcionales, debido a que el exón 8 codifica el dominio de interacción con múltiples factores de transcripción, y podría estar asociada a la diferencia funcional de la proteína en cada subespecie. El otro (C/T) no provoca un cambio de aminoácidos (figura 2).

 

 

 

El alelo A se observó en Brangus y estuvo ausente en Angus. Coincidentemente los dos grupos de secuencias de toros Brahman presentaron sólo el aleloA. Este resultado sugiere que el aleloApodría provenir de la raza cebuina, pero debe ser confirmado por secuenciación de un mayor número de animales de las tres razas (Angus, Brangus y Brahman).

FRECUENCIAS GENOTÍPICAS Y ALÉLICAS DEL SNP (G/A) DEL EXÓN 8 DEL GEN PPARGC1A

En dicho SNP, se observó una alta frecuencia de homocigotos GG (tabla XI). El alelo G fue el más frecuente (0,82) en esta muestra. Sin embargo, se debe resaltar la alta frecuencia de heterocigotos en el grupo BR2. Los resultados observados refuerzan la presunción de que el alelo A presenta mayor frecuencia en razas cebuinas. Algunos novillos Brangus conservan al menos un alelo A, probablemente a medida que aumenta el porcentaje de raza Angus disminuye la probabilidad de hallarlo en dicha raza. Estos resultados deben ser confirmados mediante el análisis de un mayor número de animales de las tres razas (Angus, Brangus y Brahman).

 

 

La falta de heterocigotos o el reducido número de ellos en algunos grupos, como la ausencia de homocigotos AA, impidió realizar un análisis estadístico con el propósito de establecer la influencia de dicho SNP sobre el contenido de grasa intramuscular y la terneza de la carne.

 

Conclusiones

GEN CAPN1

La técnica de PCR-RFLP fue la más apropiada para determinar los genotipos del SNP 4751. Se halló variabilidad en dicho SNP, hallándose los tres genotipos posibles en ambas razas analizadas. No se halló efecto del mismo sobre la RC.

GEN PPARGC1A

La técnica de PCR-RFLP permitió determinar los genotipos de los animales de la muestra para los dos SNPs analizados en este gen, localizados en el intrón 9 (C/T) y el exón 8 (G/A). El SNP del intrón 9 presentó las dos variantes posibles: alelosC y T, siendo escaso el número de genotipos homocigotos TT. No se detectó efecto del mismo sobre grasa intramuscular ni sobre terneza.

Se hallaron dos nuevos SNPs en el exón 8 de dicho gen por comparación de secuencias nuevas. Uno de ellos (G/A) provocaría la sustitución de serina por asparragina en la posición 364 de la proteína. El alelo A se halló en Brahman y Brangus pero no en Angus. El otro SNP hallado en el exón 8 (C/ T) es conservativo. Los SNPs identificados también pueden ser útiles para el estudio de la composición racial.

El estudio sobre el posible efecto de los genes potencialmente asociados con caracteres de calidad de carne en Argentina es una línea de investigación que se ha iniciado hace muy pocos años. Este trabajo contribuye al estudio de un carácter complejo habiéndose aplicado una metodología de enfoque molecular.

 

Bibliografía

AOAC. 1992. Official Methods of Analysis of the Association of Official Analytical Chemistry. Washington. 139 pp.         [ Links ]

Barton-Gade, P.A. 1988. The effect of breed on meat quality characteristics in pigs. In: Proc. Congr. Meat Aci. Technol. Australia. pp. 568-570.         [ Links ]

Boleman, S.J., Boleman, S.L., Miller, R.K., Taylor, J.F., Cross, H.R., Wheeler, T.L., Koohmaraie, M., Shackelford, S.D., Miller, M.F., West, R.L., Johnson, D.D. and Savell, J.W. 1997. Consumer evaluation of beef of known categories of tenderness. J. Anim. Sci., 75: 1521-1524.         [ Links ]

Burrow, H.M., Moore, S.S., Johnston, D.J., Barendse, W. and Bindon, B.M. 2001. Quantitative and molecular genetic influences on properties of beef: a review. Aust. J. Exp. Agr., 41: 893-919.         [ Links ]

Corva, P.M., Soria, L.A, Villarreal, E.L., Schor, A., Perez Cenci, M., Motter, M., Mezzadra, C., Melucci, L.M., Paván, E., Depetris, G., Miquel, M.C., Santini, F.J. and Grigera Naón, J.J. 2007. Association of polymorphisms on the capn1 and CAST genes with meat tenderness in beef cattle of Argentina. Genet. Mol Biol., 30: 10641069.         [ Links ]

Jacobs, K., Rohrer, G., Van Poucke, M., Piumi, F., Yerle, M., Barthenschlager, H., Mattheeuws, M., Van Zeveren, A. and Peelman, L.J. 2006. Porcine ppargc1a (peroxisome proliferative activated receptor gamma coactivator 1A): coding sequence, genomic organization, polymorphisms and mapping. Cytogenet. Genome Res., 112: 106-113.         [ Links ]

Marshall, D.M. 1999. Genetics of meat quality. In: The genetics of cattle. R.F. Fries and A. Ruvinsky (Eds.). CABI Publishing. New York. 605 pp.         [ Links ]

Miller, B. 1992. Understanding consumers. Beef today, 8: 40.         [ Links ]

Page, B.T., Casas, E., Quaas, R.L., Thallman, R.M., Wheeler, T.L., Shackelford, S.D., Koohmaraie, M., White, S.N., Bennet, G.L., Keele, J.W., Dikeman, M.E. and Smith, T.P. 2004. Association of markers in the bovine capn1 gene with meat tenderness in large crossbred populations that sample influential industry sires. J. Anim. Sci., 82: 3474-3481.         [ Links ]

Page, B.T., Casas, E., Heaton, M.P., Cullen, N.G., Hyndman, D.L., Morris, C.A., Crawford, A.M., Wheeler, T.L., Koohmaraie, M., Keele, J.W. and Smith, T.P.L. 2002. Evaluation of singlenucleotide polymorphisms in capn1 for association with meat tenderness en cattle. J. Anim. Sci., 80: 3077-3085.         [ Links ]

Sambrook, J., Fritsch, E.F. and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Cold Springer Harbor Laboratory Press. New York.         [ Links ]

Smith, T.P.L., Casas E., Rexroad III, C.E., Kappes, S.M.and Keele, J.W. 2000. Bovine capn1 maps to a region of BTA29 containing a quantitative trait locus for meat tenderness. J. Anim. Sci., 78: 2589-2594.         [ Links ]

Weikard, R., Kühn, C., Goldammer, T., Freyer, G. and Scwerin, M. 2005. The bovine ppargc1a gene: molecular characterization an association of an SNP with variation of milk fat synthesis. Physiol. Genomics. 21: 1-13.         [ Links ]

White, S.N., Casas, E., Wheeler, T.L., Shackelford, S.D., Koohmaraie, M., Riley, D.G., Chase, C.C. Jr., Johnson, D.D., Keele, J.W. and Smith, T.P.L. 2005. A new single nucleotide polymorphism in capn1 extends the current tenderness marker test to include cattle of Bos indicus, Bos taurus, and crossbreed descent. J. Anim. Sci., 83: 2001-2008.         [ Links ]

White, S.N., Casas, E., Allan, M.F., Keele, J.W., Snelling, W.M., Wheeler, T.L., Shackelford, S.D., Koohmaraie, M. and Smith, T.P.L. 2007. Evaluation in beef cattle of six deoxyribonucleic acid markers developed for dairy traits reveals an osteopontin polymorphism associed with postweaning growth. J. Anim. Sci., 85: 1-10.         [ Links ]

 

 

Recibido: 11-08-08
Aceptado: 26-11-09