SciELO - Scientific Electronic Library Online

 
vol.34 número5Polimorfismo del gen del receptor de andrógenos y oxidación máxima de grasa en hombres sanos: estudio longitudinalAsociación entre peso al nacer y factores de riesgo cardiometabólicos en niños de Bucaramanga, Colombia índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Nutrición Hospitalaria

versión On-line ISSN 1699-5198versión impresa ISSN 0212-1611

Nutr. Hosp. vol.34 no.5 Madrid sep./oct. 2017

http://dx.doi.org/10.20960/nh.913 

TRABAJO ORIGINAL / Obesidad y síndrome metabólico

 

Obesidad sarcopénica en mujeres mayores: influencia del polimorfismo I/D de la enzima convertidora de angiotensina

Sarcopenic obesity in elderly women: influence of I/D polymorphism of the angiotension converter enzyme

 

 

Cristina Romero Blanco1, María Jesús Artiga González2, Esther Cabanillas Cruz3, José Antonio Casajús Mallén4, Ignacio Ara Royo5 y Susana Aznar Laín6

1Grupo de Investigación de Promoción de la Actividad Física y la Salud (PAFS). Departamento de Enfermería, Fisioterapia y Terapia Ocupacional. Universidad de Castilla-La Mancha. Toledo.
2Biobanco. Centro Nacional de Investigaciones Oncológicas (CNIO). Instituto de Salud Carlos III. Madrid.
3Grupo de Investigación de Promoción de la Actividad Física y la Salud (PAFS). Departamento de Psicología. Universidad de Castilla-La Mancha. Toledo.
4Grupo de Investigación de Crecimiento, Ejercicio, Nutrición y Desarrollo (GENUD Research Group). Departamento de Fisiatría y Enfermería. Universidad de Zaragoza. Zaragoza.
5Grupo de Investigación de Crecimiento, Ejercicio, Nutrición y Desarrollo (GENUD Research Group). Departamento Actividad Física y Ciencias del Deporte. Universidad de Castilla-La Mancha. Toledo.
6Grupo de Investigación de Promoción de la Actividad Física y la Salud (PAFS). Departamento Actividad Física y Ciencias del Deporte. Universidad de Castilla-La Mancha. Toledo

Dirección para correspondencia

 

 


RESUMEN

Introducción: la obesidad sarcopénica (OS) es un término que relaciona el aumento de la masa grasa con la disminución de la masa muscular y que afecta a un importante porcentaje de población mayor. La falta de ejercicio regular y factores genéticos relacionados con el envejecimiento y la condición física podrían influir en su aparición.
Objetivo: determinar si las mujeres mayores de 60 años que practican de forma continuada ejercicio físico presentan diferencias en la obesidad sarcopénica en función del polimorfismo I/D del gen de la enzima convertidora de angiotensina (ACE).
Métodos: estudio transversal de 300 mujeres mayores que realizaban ejercicio físico al menos dos veces a la semana en los últimos dos años. Se tomaron datos de medidas antropométricas, cuestionario de comportamiento actividad-sedentarismo, evaluación de la obesidad sarcopénica (a través de la determinación del porcentaje de masa grasa y masa muscular total mediante impedancia eléctrica y la agrupación de los quintiles de estos valores en cuatro grupos), evaluación de la condición física y genotipado del gen ACE mediante extracción de ADN de mucosa oral.
Resultados: se encontraron diferencias significativas en la obesidad sarcopénica en función del genotipo I/D de ACE. Las mujeres del grupo ACE DD presentaron menor riesgo de padecer obesidad sarcopénica que aquellas con genotipo ACE II y ACE ID (valores OS: 2.18 genotipo ACE DD frente a 2.48 genotipo ACE II + ACE ID; p < 0,05).
Conclusiones: las mujeres mayores de 60 años con genotipo ACE DD que practican ejercicio regularmente presentan menor riesgo de padecer obesidad sarcopénica.

Palabras clave: Personas mayores. Polimorfismo genético. Sarcopenia. Obesidad. Actividad física.


ABSTRACT

Introduction: Sarcopenic obesity (SO) is a term that refers to an increase of fat mass together with a decrease of muscle mass, which is suffered by a high percentage of elderly population. Physical activity seems to be a good strategy to prevent it getting worse. However, genetic factors related to the aging process and to elderly's physical fitness could have an influence on it.
Aim: To determine if elderly women > 60 who practice physical activity regularly had differences in sarcopenic obesity according to the I/D polymorphism from the ACE (angiotensin converter enzyme) gen.
Methods: Cross-sectional study of 300 elderly women who have practiced physical exercise at least twice a week for the past two years. Anthropometric data, physical activity and sedentary behaviour questionnaire, sarcopenic obesity (determining the percentage of fat mass and total muscle mass by electrical impedance and grouping the quintiles of these values into four groups) and physical fitness assessment, as well as ACE gen genotype measured by oral mucosa sample, were evaluated.
Results: There were significant differences (p < 0.05) in sarcopenic obesity according to ACE I/D genotype (SO values: 2.18 ACE DD vs 2.48 ACE II + ACE ID).
Conclusions: Women who were ACE DD presented lower risk of sarcopenic obesity than those in the ACE II and ACE ID groups.

Key words: Elderly. Genetic polymorphism. Sarcopenia. Obesity. Exercise.


 

Introducción

La Organización Mundial de la Salud (OMS) se marcó como objetivo hace algunas décadas el envejecimiento activo de la población como medida que favoreciera en este colectivo las oportunidades de salud biopsicosocial (1). Y desde entonces los estudios se han centrado en descubrir las causas que pudieran facilitar una mejor calidad de vida de ancianos, centrándose varios de ellos en el desarrollo de capacidades físicas como medida de envejecimiento saludable (2-4).

El envejecimiento se ha relacionado con la obesidad sarcopénica, término que agrupa la relación del aumento de masa grasa (obesidad) con una disminución de la masa muscular: sarcopenia (5). Se estima que un 15% de la población española anciana presenta obesidad sarcopénica y que existe una estrecha relación entre los niveles de adiposidad y el estilo de vida activo o sedentario que tengan nuestros mayores (6).

Las relaciones establecidas entre la obesidad sarcopénica y la inactividad han hecho que la condición física se perfile como un buen indicador de obesidad sarcopénica (7).

Al mismo tiempo que se estudian estos factores y su efecto en el envejecimiento saludable, otros grupos buscan condicionantes genéticos que puedan influir también en el deterioro de las capacidades físicas (8). Hasta el momento, el polimorfismo genético mejor caracterizado en relación al ejercicio es la presencia o ausencia (inserción/delección; I/D) de un fragmento de 287 pb en el intrón 16 de la enzima convertidora de angiotensina (ACE) (9).

El alelo I se asocia con una menor actividad de ACE sistémico y un aumento de la vida media de la bradiquinina, mientras que el alelo D se asocia con una mayor actividad de ACE, mayores concentraciones de angiotensina 2 y menores de bradiquinina (10,11). Estas respuestas diferentes en cuanto a la modulación del sistema renina-angiotensina (RAS) según el genotipo tienen implicaciones en la respuesta a la adaptación al ejercicio.

A pesar de ser un gen ampliamente estudiado en el deporte profesional (12), son pocos los estudios en los que se relaciona el genotipo de ACE con la condición física en personas mayores (13). En varios estudios realizados en mayores se ha encontrado una relación entre el alelo D y mejores resultados en velocidad, fuerza, agilidad y/o resistencia (10,14-18). Sin embargo, otros estudios no encontraron relación con ninguna de las variables de condición física analizadas (19-26).

Nos proponemos con nuestro trabajo realizar un estudio transversal en una amplia muestra de mujeres mayores activas para analizar si existe relación entre el genotipo de ACE y la obesidad sarcopénica. Pretendemos averiguar también si las mujeres mayores que realizan actividad física de forma rutinaria presentan algún tipo de diferencia en su condición física en relación a su genotipo.

 

Material y métodos

Este estudio ha sido elaborado de acuerdo al Código Ético de la Asociación Médica Mundial (Declaración de Helsinki).

La muestra estuvo compuesta por un total de 300 mujeres mayores de 60 años con edades comprendidas entre los 60 y los 91 años (edad media de 73,73 ± 5,4 años).

Todos los participantes de nuestro estudio realizaban ejercicio físico a través de los programas de actividad física para personas mayores no institucionalizadas de su comunidad dos veces a la semana durante al menos los dos últimos años.

La población objeto de este estudio fue seleccionada del proyecto multicéntrico EXERNET (Red de investigación de ejercicio físico y salud para poblaciones especiales) (6). Previo al comienzo del reclutamiento de donantes, el documento de consentimiento informado fue aprobado por el comité de ética correspondiente (adscrito a la Universidad de Castilla-La Mancha). Con la recogida de dicho consentimiento se informó a los participantes de los posibles riesgos y beneficios de las pruebas que se les iban a realizar.

Los donantes fueron seleccionados de acuerdo a los siguientes requisitos: ser mayor de 60 años, no estar institucionalizados, pertenecer a un grupo de actividad física programada en su municipio y haber firmado el consentimiento informado.

MEDIDAS ANTROPOMÉTRICAS

En todos los sujetos se determinó el peso (tallímetro portátil SECA711), la talla y el porcentaje de masa grasa total (%MG) con un equipo de impedancia bioeléctrica (Tanita BC 418-MA, Tanita Corp., Tokio, Japón) y el índice de masa corporal (IMC) mediante la relación IMC = kg/m2.

ESTILO DE VIDA

Del cuestionario validado diseñado para el "estudio multicéntrico EXERNET para la evaluación de la condición física en personas mayores" (27) se extrajeron las variables "actividad": número de horas que camina al día; sedentarismo": número de horas que pasa sentado al día (viendo la tele, leyendo, cosiendo, etc.); y "tareas del hogar": número de horas dedicadas a las tareas del hogar.

Se codificaron en seis grupos en función del número de horas (28): 1 (entre cero y una hora), 2 (más de una y hasta dos horas), 3 (más de dos y hasta tres horas), 4 (más de tres y hasta cuatro horas), 5 (más de cuatro y hasta cinco horas) y 6 (más de cinco horas).

EVALUACIÓN DE LA OBESIDAD SARCOPÉNICA

La variable obesidad sarcopénica (OS) se calculó siguiendo el criterio de Gómez Cabello y distinguiendo cuatro grupos (6): 1 (composición muscular y grasa normal), 2 (alta grasa corporal y masa muscular normal), 3 (baja masa muscular y grasa normal) y 4 (obesidad sarcopénica: alta grasa corporal y baja masa muscular).

EVALUACIÓN DE LA CONDICIÓN FÍSICA

Para evaluar la condición física se realizaron diferentes test adaptados de la batería Senior Fitness Test (4,29,30):

- Equilibrio. Test de flamingo: tiempo en segundos que es capaz de sostenerse sobre un pie, hasta un máximo de 60 segundos.

- Fuerza en extremidades inferiores. Chair stand test: número de veces que es capaz de ponerse de pie desde una silla en 30 segundos.

- Fuerza en extremidades superiores. Arm curl test: número de veces que realiza una flexoextensión con una mancuerna de 2,5 kg en 30 segundos.

- Flexibilidad de extremidades inferiores. Chair sit and reach test: distancia en centímetros desde las manos a la punta de los pies al realizar una flexión de tronco en sedestación.

- Flexibilidad de extremidades superiores. Back scratch test: distancia en centímetros entre ambas manos al intentar que se toquen por la espalda diagonalmente.

- Agilidad. 8-foot up-and-go test: tiempo en segundos que tarda en realizar un circuito comenzando desde sedestación.

- Velocidad. Brisk walking test: tiempo en segundos que tarda en recorrer 30 metros caminando.

- Resistencia. 6-minute walk test: metros que es capaz de recorrer en seis minutos.

DETERMINACIÓN DEL GENOTIPO

Obtención de ADN

El ADN genómico se obtuvo de la mucosa bucal de los participantes mediante un procedimiento estandarizado de extracción con fenol/cloroformo y posterior precipitación en alcohol en presencia de sales (31).

Amplificación de ADN e identificación del polimorfismo

Se amplificó mediante reacción en cadena de la polimerasa (PCR) (32) un fragmento del intrón 16 del gen ACE. El resultado de la PCR resultante se visualizó mediante gel de agarosa 1,5% con bromuro de etidio en el que se detectaron dos tipos de fragmentos: uno de 478 pb (pares de bases) correspondiente al alelo I y otro de 191 pb correspondiente al alelo D. Los cebadores usados fueron: 5'-TGGAGAGCACTCCCATCCTTTCT y 5'-GACGTGGCCATCACATTCGTCAGAT. Las condiciones de PCR fueron las siguientes: desnaturalización inicial a 95o cinco minutos; 35 ciclos de 30 segundos 95o, 30 segundos 58o, un minuto 72o y cinco minutos de extensión final a 72o.

Para asegurar el correcto genotipado de los casos DD y evitar casos en los que se pueda confundir el genotipo DD con ID se realizó una nueva PCR (33) utilizando los siguientes cebadores: 5'- TGGGACCACAGGCGCCCGCCACTAC y 5'-TCGCCAGCCCTCCCATGCCCATAA. Las condiciones de PCR fueron iguales a las anteriores excepto por la temperatura de anillamiento, que en este caso fue de 64 oC. En gel de agarosa al 1,5% con bromuro de etidio se detectó un fragmento de 335 pb correspondiente al alelo I. La amplificación por PCR se hizo utilizando Applied Biosystems GeneAmp PCR System 9700.

ANÁLISIS ESTADÍSTICO

Los datos obtenidos del presente estudio han sido analizados con el paquete estadístico SPSS (versión 20.0). Se realizaron análisis descriptivos teniendo en cuenta medidas de tendencia central, medidas de asimetría y medidas de forma. Se realizó la prueba de normalidad utilizando el criterio de Kolmogorov-Smirnov.

Para valorar el equilibrio de Hardy-Weinberg de la muestra se realizó estudio de Chi-cuadrado.

Se realizó un estudio cuantitativo para valorar la influencia de las variables genéticas con el resto de parámetros estudiados. Teniendo en cuenta que los datos se alejan del comportamiento normal, el análisis estadístico se ha realizado mediante la prueba no paramétrica de Kruskal-Wallis. Se trabajó con un nivel de confianza de un 95% (p < 0,05). Asimismo, se utilizó la prueba de Bonferroni para comparar diferencias entre los tres genotipos de ACE.

 

Resultados

Se analizaron un total de 300 muestras de mucosa oral de las que se obtuvo un ADN óptimo para su amplificación en 282 casos. El genotipo de las participantes presentó una distribución ajustada al equilibrio de Hardy-Weinberg: II = 46: 16%; ID = 131: 47%; DD = 105: 37%. No existieron diferencias significativas en dicha distribución (χ² = 0,23; p = 0,63).

En la tabla I se presentan los resultados correspondientes al analizar las diferencias en todas las variables del estudio entre los tres genotipos: ACE II, ACE ID y ACE DD, mediante la prueba de Kruskal-Wallis. Se obtuvieron diferencias significativas en la variable obesidad sarcopénica (p < 0,05).

Se realizó la prueba de Bonferroni para la variable obesidad sarcopénica al ser la única en obtener diferencias significativas atribuibles al genotipo de ACE en la prueba de Kruskal-Wallis. Se observaron diferencias significativas en el genotipo ACE ID con respecto a los genotipos II y DD (p = 0,02 y p = 0,01, respectivamente). El genotipo heterocigoto obtuvo resultados menos saludables en cuanto a la obesidad sarcopénica.

Se realizó la agrupación del genotipo de ACE en dos grupos (12): ACE DD frente a ACE ID + II. De nuevo, se observaron diferencias significativas en la variable obesidad sarcopénica. En la tabla II se muestran los resultados obtenidos al analizar el efecto del genotipo agrupado de ACE frente a las variables estudiadas.

El grupo ACE DD obtuvo un resultado significativamente inferior en esta variable frente al grupo ACE ID + II y, por tanto, menor riesgo de padecer obesidad sarcopénica.

 

Discusión

Nuestros resultados revelan un efecto favorable en las mujeres con genotipo ACE DD en cuanto a padecer menor riesgo de obesidad sarcopénica. En el resto de variables no se observaron diferencias significativas.

Este estudio en personas mayores contiene una de las mayores muestras analizadas hasta el momento en relación al genotipo de ACE y la condición física. Lo más notable de nuestro estudio radica en el hecho de que todos nuestros participantes llevan realizando un programa de actividad física dos veces a la semana durante al menos los dos últimos años y por lo tanto, podemos valorar el efecto del genotipo en personas mayores activas. Desde nuestro conocimiento, es el estudio transversal con el mayor número de mujeres mayores activas analizado.

Nuestros resultados no revelaron ninguna diferencia significativa entre las variables de condición física y los distintos genotipos de ACE, pero sí se halló relación con la obesidad sarcopénica en mujeres, siendo el grupo ACE DD el de menor riesgo de padecer esta condición. Todos nuestros sujetos habían realizado ejercicio físico en los dos últimos años, por lo que se podrían comparar nuestros hallazgos con otros trabajos en los que se valoró el efecto de ACE tras un entrenamiento, a pesar de ser nuestro trabajo un estudio transversal.

McCauley y cols. (25) publicaron un estudio en el que analizaron este genotipo solo en hombres, y tampoco encontraron ninguna diferencia significativa entre ACE y las variables antropométricas, ni tampoco en las pruebas físicas. Hasta ahora no conocemos ningún estudio donde se haya relacionado la obesidad sarcopénica con el genotipo I/D de ACE con un enfoque experimental parecido al nuestro. Garatachea y cols. (23) utilizaron una escala diferente de valoración de sarcopenia y no encontraron resultados significativos. Podemos explicar esta diferencia por dos razones: por un lado, como hemos comentado, su método de valoración fue diferente al nuestro, y por otro, la muestra empleada fue pequeña (89 sujetos) comparada con la nuestra (300 mujeres).

A pesar de no haberse estudiado la obesidad sarcopénica previamente, sí se ha estudiado el efecto de la masa libre de grasa en grupos de mayores, por lo que, de alguna manera, podemos relacionar los datos. Lima y cols. (24) en su trabajo destacaron la relación de ACE con la masa libre de grasa (FFM), siendo los del grupo ACE DD los que más FFM tuvieron al compararlos con los otros dos genotipos. Charbonneau y cols. (20) encontraron también mayores valores de masa libre de grasa tanto en hombres como en mujeres en el genotipo DD frente al grupo II.

Nuestros resultados son similares a aquellos trabajos que mostraron una relación entre la longevidad y el genotipo de ACE (34-36), siendo el alelo D favorable en cuanto a longevidad. En su estudio, Kritchevsky y cols. (37) también relacionaron el alelo D con un grupo de mayores activos (aquellos que gastaban más de 1.000 calorías semanales en actividad física), y vieron que estos tenían menor riesgo de padecer limitación de la movilidad. En el grupo de mayores inactivos que estudiaron no encontraron esta relación. Podemos deducir, por tanto, un efecto favorable del alelo D en la calidad y cantidad de vida en mayores activos.

Respecto a la ausencia de resultados significativos encontrados entre las variables de condición física y el genotipo, otros estudios en mayores presentaron similares hallazgos. Okamoto y cols. (26) no encontraron diferencias significativas por genotipo en el número de pasos al día ni en las variables de resistencia y fuerza tras un entrenamiento de 24 semanas. Frederiksen y cols. (21) en su estudio tampoco encontraron diferencias significativas entre el genotipo y la condición física con entrenamiento o sin él. Su estudio tampoco halló relación con la masa libre de grasa, pero presentó una gran clasificación en cuatro grupos de entrenamiento y otros cuatro de control, lo que generó un pequeño número de muestra por grupo en su análisis estadístico, restándole potencia estadística. En su estudio de gemelos mayores, Frederiksen y cols. (22) tampoco encontraron diferencias significativas con las variables de condición física, así como Garatachea y cols. (23), cuyo estudio en octogenarios tampoco obtuvo relación con el genotipo de ACE.

Sin embargo, otros estudios sí han hallado diferencias en la condición física atribuibles al genotipo. Buford y cols. (10) no obtuvieron diferencias significativas en las variables antropométricas entre su grupo control y el grupo problema, pero observaron que los portadores del alelo D presentaron mejores resultados en condición física que los ACE II tras un entrenamiento de 12 semanas comparado con un grupo control. En el presente estudio no se han comparado nuestros resultados con un grupo de mayores inactivos, por lo que no sabemos si habríamos obtenido resultados similares, pero sí podemos afirmar de nuevo una posición ventajosa del alelo D para aquellos sujetos activos.

A pesar de obtener resultados contrarios a nuestro estudio en las variables físicas, varios autores también sugieren un papel ventajoso del genotipo DD tras el entrenamiento. Giaccaglia y cols. (14) encontraron que tras 18 semanas de ejercicio, los individuos portadores del genotipo DD obtuvieron mejores resultados en fuerza de piernas que los ACE II. No encontraron resultados en resistencia, pero hallaron resultados próximos a la significación estadística en la escala de discapacidad, donde el genotipo DD obtuvo resultados mejores tras el entrenamiento. Del mismo modo, Pereira y cols. (16,17) encontraron mejores resultados en velocidad, fuerza y potencia (pero no en las pruebas de agilidad) tras un entrenamiento de 12 semanas en mujeres con alelo D.

No hemos obtenido diferencias significativas entre el genotipo de ACE y las variables de condición física. Los sujetos analizados en nuestro estudio, sin embargo, no han completado el tiempo dedicado a realizar actividad física solo con la actividad física organizada por la comunidad, ya que es inferior a lo recomendado. Las recomendaciones generales sobre la práctica de ejercicio físico en edades avanzadas son realizar un mínimo de 30 minutos de ejercicio aeróbico de intensidad moderada cinco días a la semana o 20 minutos de actividad vigorosa aeróbica tres días a la semana (38). Los mayores analizados realizan actividad física dos veces a la semana durante una hora, por lo que no llegan al mínimo recomendado.

Como limitaciones a este estudio señalamos la falta de una medida objetiva que cuantifique la cantidad de actividad física semanal que realizan nuestros sujetos. También sería interesante realizar un estudio prospectivo que permitiese valorar el efecto del genotipo en dos tiempos. Por otro lado, habría sido interesante incluir una muestra similar de hombres en nuestro estudio, aunque las mujeres son las que acuden mayoritariamente a los programas de actividad física organizados por la comunidad. Y, como señalamos anteriormente, deberíamos haber incluido un grupo control de sujetos inactivos para poder comparar nuestros resultados frente a ellos.

A la vista de todos estos resultados y como conclusión final, podemos establecer un factor protector de riesgo de obesidad sarcopénica para aquellas mujeres portadoras del genotipo ACE DD y que realizan ejercicio físico de forma continuada. Parece que existe un papel beneficioso de este genotipo de ACE en las mujeres mayores que practican deporte varias veces a la semana.

Podemos afirmar, por tanto, que el genotipo ACE DD se asocia a un menor riesgo de obesidad sarcopénica en mujeres activas.

 

Bibliografía

1. Organization WH. Active aging: A policy framework. Madrid: WHO/NMH/NPH/02.8; 2002.         [ Links ]

2. Castillo Garzón MJ, Ortega Porcel FB, Ruiz Ruiz J. Improvement of physical fitness as anti-aging intervention. Med Clin (Barc) 2005;124(4):146-55.         [ Links ]

3. Wilkin LD, Haddock BL. Health-related variables and functional fitness among older adults. Int J Aging Hum Dev 2010;70(2):107-18.         [ Links ]

4. Rikli RE, Jones CJ. Development and validation of criterion-referenced clinically relevant fitness standards for maintaining physical independence in later years. Gerontologist 2013;53(2):255-67.         [ Links ]

5. Stenholm S, Harris TB, Rantanen T, Visser M, Kritchevsky SB, Ferrucci L. Sarcopenic obesity: Definition, cause and consequences. Curr Opin Clin Nutr Metab Care 2008;11(6):693-700.         [ Links ]

6. Gómez-Cabello A, Pedrero-Chamizo R, Olivares PR, Luzardo L, Juez-Bengoechea A, Mata E, et al. Prevalence of overweight and obesity in non-institutionalized people aged 65 or over from Spain: The elderly EXERNET multi-centre study. Obes Rev 2011;12(8):583-92.         [ Links ]

7. Munoz-Arribas A, Mata E, Pedrero-Chamizo R, Espino L, Gusi N, Villa G, et al. Sarcopenic obesity and physical fitness in octogenarians: The multi-center EXERNET Project. Nutr Hosp 2013;28(6):1877-83.         [ Links ]

8. Garatachea N, Lucia A. Genes, physical fitness and ageing. Ageing Res Rev 2013;12(1):90-102.         [ Links ]

9. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86(4):1343-6.         [ Links ]

10. Buford TW, Hsu FC, Brinkley TE, Carter CS, Church TS, Dodson JA, et al. Genetic influence on exercise-induced changes in physical function among mobility-limited older adults. Physiol Genomics 2014;46(5):149-58.         [ Links ]

11. Murphey LJ, Gainer JV, Vaughan DE, Brown NJ. Angiotensin-converting enzyme insertion/deletion polymorphism modulates the human in vivo metabolism of bradykinin. Circulation 2000;102(8):829-32.         [ Links ]

12. Ma F, Yang Y, Li X, Zhou F, Gao C, Li M, et al. The association of sport performance with ACE and ACTN3 genetic polymorphisms: A systematic review and meta-analysis. PLoS One 2013;8(1):e54685.         [ Links ]

13. Garatachea N, Lucía A. Genes and the ageing muscle: A review on genetic association studies. Age (Dordr) 2013;35(1):207-33.         [ Links ]

14. Giaccaglia V, Nicklas B, Kritchevsky S, Mychalecky J, Messier S, Bleecker E, et al. Interaction between angiotensin converting enzyme insertion/deletion genotype and exercise training on knee extensor strength in older individuals. Int J Sports Med 2008;29(1):40-4.         [ Links ]

15. Keogh JW, Palmer BR, Taylor D, Kilding AE. ACE and UCP2 gene polymorphisms and their association with baseline and exercise-related changes in the functional performance of older adults. Peer J 2015;3:e980.         [ Links ]

16. Pereira A, Costa AM, Izquierdo M, Silva AJ, Bastos E, Marques MC. ACE I/D and ACTN3 R/X polymorphisms as potential factors in modulating exercise-related phenotypes in older women in response to a muscle power training stimuli. Age (Dordr) 2013;35(5):1949-59.         [ Links ]

17. Pereira A, Costa AM, Leitao JC, Monteiro AM, Izquierdo M, Silva AJ, et al. The influence of ACE ID and ACTN3 R577X polymorphisms on lower-extremity function in older women in response to high-speed power training. BMC Geriatr 2013;13:131.         [ Links ]

18. Yoshihara A, Tobina T, Yamaga T, Ayabe M, Yoshitake Y, Kimura Y, et al. Physical function is weakly associated with angiotensin-converting enzyme gene I/D polymorphism in elderly Japanese subjects. Gerontology 2009;55(4):387-92.         [ Links ]

19. Bustamante-Ara N, Santiago C, Verde Z, Yvert T, Gómez-Gallego F, Rodríguez-Romo G, et al. ACE and ACTN3 genes and muscle phenotypes in nonagenarians. Int J Sports Med 2010;31(4):221-4.         [ Links ]

20. Charbonneau DE, Hanson ED, Ludlow AT, Delmonico MJ, Hurley BF, Roth SM. ACE genotype and the muscle hypertrophic and strength responses to strength training. Med Sci Sports Exerc 2008;40(4):677-83.         [ Links ]

21. Frederiksen H, Bathum L, Worm C, Christensen K, Puggaard L. ACE genotype and physical training effects: a randomized study among elderly Danes. Aging Clin Exp Res 2003;15(4):284-91.         [ Links ]

22. Frederiksen H, Gaist D, Bathum L, Andersen K, McGue M, Vaupel JW, et al. Angiotensin I-converting enzyme (ACE) gene polymorphism in relation to physical performance, cognition and survival - A follow-up study of elderly Danish twins. Ann Epidemiol 2003;13(1):57-65.         [ Links ]

23. Garatachea N, Fiuza-Luces C, Torres-Luque G, Yvert T, Santiago C, Gómez-Gallego F, et al. Single and combined influence of ACE and ACTN3 genotypes on muscle phenotypes in octogenarians. Eur J Appl Physiol 2012;112(7):2409-20.         [ Links ]

24. Lima RM, Leite TK, Pereira RW, Rabelo HT, Roth SM, Oliveira RJ. ACE and ACTN3 genotypes in older women: Muscular phenotypes. Int J Sports Med 2011;32(1):66-72.         [ Links ]

25. McCauley T, Mastana SS, Folland JP. ACE I/D and ACTN3 R/X polymorphisms and muscle function and muscularity of older Caucasian men. Eur J Appl Physiol 2010;109(2):269-77.         [ Links ]

26. Okamoto N, Nakatani T, Okamoto Y, Iwamoto J, Saeki K, Kurumatani N. Increasing the number of steps walked each day improves physical fitness in Japanese community-dwelling adults. Int J Sports Med 2010;31(4):277-82.         [ Links ]

27. Lopez-Rodríguez C, Laguna M, Gómez-Cabello A, Gusi N, Espino L, Villa G, et al. Validation of the self-report EXERNET questionnaire for measuring physical activity and sedentary behavior in elderly. Arch Gerontol Geriatr 2016;69:156-61.         [ Links ]

28. Gómez-Cabello A, Pedrero-Chamizo R, Olivares PR, Hernández-Perera R, Rodríguez-Marroyo JA, Mata E, et al. Sitting time increases the overweight and obesity risk independently of walking time in elderly people from Spain. Maturitas 2012;73(4):337-43.         [ Links ]

29. Morales S, Gómez-Cabello A, González-Aguero A, Casajus JA, Ara I, Vicente-Rodríguez G. Sedentarism and physical fitness in postmenopausal women. Nutr Hosp 2013;28(4):1053-9.         [ Links ]

30. RE R, CJ J. Senior Fitness Test Manual. United States of America: Human Kinetics; 2001.         [ Links ]

31. Lum A, Le Marchand L. A simple mouthwash method for obtaining genomic DNA in molecular epidemiological studies. Cancer Epidemiol Biomarkers Prev 1998;7(8):719-24.         [ Links ]

32. Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res 1992;20(6):1433.         [ Links ]

33. Shanmugam V, Sell KW, Saha BK. Mistyping ACE heterozygotes. PCR Methods Appl 1993;3(2):120-1.         [ Links ]

34. Galinsky D, Tysoe C, Brayne CE, Easton DF, Huppert FA, Dening TR, et al. Analysis of the apo E/apo C-I, angiotensin converting enzyme and methylenetetrahydrofolate reductase genes as candidates affecting human longevity. Atherosclerosis 1997;129(2):177-83.         [ Links ]

35. Seripa D, Franceschi M, Matera MG, Panza F, Kehoe PG, Gravina C, et al. Sex differences in the association of apolipoprotein E and angiotensin-converting enzyme gene polymorphisms with healthy aging and longevity: A population-based study from Southern Italy. J Gerontol A Biol Sci Med Sci 2006;61(9):918-23.         [ Links ]

36. Schachter F, Faure-Delanef L, Guenot F, Rouger H, Froguel P, Lesueur-Ginot L, et al. Genetic associations with human longevity at the APOE and ACE loci. Nat Genet 1994;6(1):29-32.         [ Links ]

37. Kritchevsky SB, Nicklas BJ, Visser M, Simonsick EM, Newman AB, Harris TB, et al. Angiotensin-converting enzyme insertion/deletion genotype, exercise, and physical decline. JAMA 2005;294(6):691-8.         [ Links ]

38. Gremeaux V, Gayda M, Lepers R, Sosner P, Juneau M, Nigam A. Exercise and longevity. Maturitas 2012;73(4):312-7.         [ Links ]

 

 

Dirección para correspondencia:
Cristina Romero Blanco.
Grupo de Investigación de Promoción de la Actividad Física y la Salud (PAFS).
Departamento de Enfermería, Fisioterapia y Terapia Ocupacional.
Universidad de Castilla-La Mancha.
Avda. de Carlos III.
45004 Toledo.
e-mail: cristina.romero@uclm.es

Recibido: 12/01/2017
Aceptado: 06/03/2017

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons