SciELO - Scientific Electronic Library Online

 
vol.96 número12Ampulectomía transduodenal en el tratamiento de los adenomas vellosos y adenocarcinomas de la ampolla de VaterResección endoscópica asistida por ecoendoscopia de tumores carcinoides del aparato digestivo índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Revista Española de Enfermedades Digestivas

versión impresa ISSN 1130-0108

Rev. esp. enferm. dig. vol.96 no.12  dic. 2004

 

TRABAJOS ORIGINALES


Hepatitis post-transfusional en neonatos encamados en una Unidad de Cuidados Intensivos Neonatal

A. Ruiz-Extremera, J. Salmerón1, M. L. Rey, C. Torres1, P. Muñoz de Rueda1, E. Ocete y J.D. Luna2

Departamento de Pediatría. 1Departamento de Digestivo. Hospital Universitario San Cecilio. 2Departamento de Bioestadística. Facultad de Medicina. Universidad de Granada. Granada

 

RESUMEN

Objetivo: estudiar la importancia y significado del aumento de transaminasas en neonatos que ingresaron en una Unidad de Cuidados Intensivos Neonatales y su relación con la transfusión sanguínea.
Métodos:
seguimiento prospectivo de 209 pacientes de los cuales 177 completaron el seguimiento: 129 transfundidos y 48 no transfundidos (57 nacidos a término y 120 prematuros). Se determinaron la ALT, AST y GGT mensualmente hasta los seis meses de edad y hasta los seis meses de la última transfusión. Al final del seguimiento y cuando había un aumento de transaminasas se investigó el virus de la hepatitis A, B, C, G, TT, citomegalovirus, Epstein-Barr, herpes 1-2 y toxoplasma. La serología viral también se estudió en todas las madres y en los niños positivos en sus donantes.
Resultados:
ciento veintinueve neonatos (73%) recibieron 461 U/concentrados-hematíes (3,6 ± 3 U/paciente). Cincuenta y cuatro pacientes (30,5%) presentaron un aumento de ALT, 46 (36%) transfundidos y 8 (17%) no transfundidos (p < 0,05). Las variables independientes asociadas con este aumento de las transaminasas fueron: la infección con el virus G, la nutrición parenteral durante más de 12 días y, con casi significación estadística, la transfusión. Veinte pacientes (11,3%) tenían un aumento de ALT superior a 2,5 veces el valor normal: 18 (14%) transfundidos, 2 (4%) no transfundidos (p = 0,106). Sólo el virus G y el virus TT se relacionaron con la transfusión; el curso clínico fue asintomático, aunque la mayoría quedaron crónicamente infectados.
Conclusión:
en el seguimiento de los neonatos graves, el aumento de las transaminasas es frecuente. Las transfusiones son seguras para la mayoría de los virus hepatotropos, pero es posible la transmisión de los virus G y TT.

Palabras clave: Hepatitis postransfusional. Recién nacidos. Recién nacidos prematuros. Unidad de Cuidados Intensivos Neonatales (UCIN). Virus de la hepatitis G. Virus de la hepatitis TT.


Proyecto financiado: Fondo de Investigaciones sanitarias 95/1524, Junta de Andalucía, Nº 84/99 y Red Nacional de Investigación en Hepatología y Gastroenterología (RNIHG).

 

INTRODUCCIÓN

Los pacientes críticamente enfermos requieren a menudo hemoderivados como terapia (1). Los recién nacidos (RN) ingresados en Unidades de Cuidados Intensivos Neonatales (UCIN) reciben sobre todo concentrados de hematíes. En EE.UU. se estima que el 80% de los nacidos con menos de 1.500 g son transfundidos (2,3). En los últimos años han aparecido guías de práctica clínica para homogeneizar las indicaciones de transfusión. Aunque la administración de eritropoyetina alfa recombinante humana (EPO) ha permitido disminuir esta práctica, parece que esta disminución está relacionada con unos criterios de transfusión más estrictos (2-4). Las indicaciones para la administración de concentrados de hematíes a neonatos incluyen: la expansión de volumen, la enfermedad cardiorrespiratoria, anemia, falta de crecimiento y apneas. También se han utilizado como predictores los criterios demográficos, las pérdidas por flebotomías, el hematocrito inicial (3,4) y el peso al nacimiento (5).

En los nacidos con menos de 1.000 g (6) de peso, el uso de EPO precoz no disminuye el número de transfusiones ni el de niños que la precisaron. También se ha comunicado (7) que los neonatos anémicos aparentemente estables, presentan alteraciones hemodinámicas ecocardiográficas, que no mejoran en las 48 horas que siguen a la transfusión, situación indeseable y potencialmente peligrosa. Otro hecho de interés es la variabilidad en la práctica clínica de unas UCIN a otras (8) y aunque se suceden las publicaciones intentando clarificar las indicaciones, la eficacia y seguridad de la misma no está bien definida (9).

Los estudios de hepatitis postransfusional (HPT) en niños son escasos y retrospectivos (10,11). Por las publicaciones en adultos se conoce la reducción de la HPT. El virus de la hepatitis C (VHC) fue el principal causante de la HPT noA-noB, sin embargo, desde que se impuso la obligatoriedad de determinar los anti-VHC a los donantes de sangre, la tasa de HPT oscila entre 0,85-3,5% (12-14) y las posibilidades actuales de transmitir una infección por el VHC son prácticamente nulas (15).

Recientemente se han reconocido nuevos agentes virales de transmisión parenteral, concretamente, el virus de la hepatitis G (VHG) y el virus transmitido por la transfusión (VTT). El VHG se detectó en el 8,6% de un grupo de adultos transfundidos, aunque ninguno de ellos presentó criterios de HPT (15) y en ningún caso se ha demostrado replicación hepática de este virus (16). El VTT es un virus transmisible por la sangre, de la madre al hijo (17) y también por vía fecal-oral (18) y ha sido detectado en pacientes con HPT noA a noG (19).

El objetivo del estudio fue conocer la importancia y el significado del aumento de las transaminasas en niños que precisaron ingreso en una UCIN en el periodo neonatal y la seguridad de la transfusión.

MÉTODOS

Desde mayo de 1995 hasta diciembre de 1998 se incluyeron 209 RN, en un estudio de seguimiento prospectivo, previo consentimiento informado de los padres y la aprobación del Comité de Ética del Hospital. Completaron el estudio 177 RN (129 transfundidos y 48 no transfundidos), 32 fueron excluidos por pérdida del seguimiento. Del total de pacientes que completaron el estudio, 57 nacieron a término y 120 fueron prematuros, 56 de ellos con un peso inferior a los 1.500 g. Todos precisaron ingreso en UCIN y fueron dados de alta del hospital.

El seguimiento fue mensual hasta los seis meses de vida o seis meses después de la última transfusión. En los niños con aumento de ALT se prolongó el seguimiento con visitas semestrales, la media del seguimiento fue de 18,7 ± 9 (12-48) meses. En cada revisión se determinó la ALT, AST, GGT. En el tercero y sexto mes se congeló (-80 ºC) un ml de suero. En la última revisión y en los aumentos de ALT se investigó el virus de la hepatitis A (VHA), hepatitis B (VHB), VHC, citomegalovirus (CMV), Epstein-Barr (VEB), herpes 1-2, VHG y VTT. En todas las madres, ante la posibilidad de una transmisión vertical, y en los donantes se realizó el estudio virológico y se congeló el suero.

El VHG y VTT se determinó sólo cuando el niño era positivo. Los productos transfundidos fueron negativos para anti-VHC (ELISA 3), HBsAg, VIH, sífilis y se excluyeron a los donantes con ALT aumentada. Se consideró que reunían criterios de HPT a los pacientes que presentaban aumentos de la ALT 2,5 veces el valor máximo normal entre los 14-180 días tras la transfusión, comprobado en una segunda determinación (20).

Los parámetros bioquímicos se determinaron con el analizador automático HITACHI-717 (Boehringer-Mannheim). Los marcadores del VHA (anti-VHAIgM), VHB (anti-HBcIgM, HBsAg) y CMV se estudiaron mediante ELISA. El VEB por inmunofluorescencia indirecta. El VHC, mediante ELISA 3, RIBA3 (Ortho), el ARN VHC se determinó en suero mediante RT-PCR cualitativa, con el Kit Amplicor HCV (Roche Diagnostics System), siguiendo las instrucciones de uso.

El análisis del ARN-VHG se realizó por amplificación y detección de dos regiones genómicas independientes: la 5' no codificante (5'NCR) y la que codifica la proteína NS5a. La detección de estas dos regiones se llevó a cabo en reacciones independientes de RT-PCR (Boehringer Mannheim). Este método se empleó de forma aislada para los pacientes con ALT aumentada y de forma agrupada (pools) para estudiar a los pacientes con transaminasas normales y en los casos positivos se repitió de forma aislada. Para el estudio de los anticuerpos se usó una técnica de enzimo-inmunoanálisis (ELISA-VHG, Boehringer Mannheim), que detecta cualitativamente anti-VHGE2.

Para la determinación del VTT, la extracción del ADN se realizó de 150 µl de suero usando Nucleo Spin Virus Kit (Clontech Laboratories GmbH) y resuspendido en 50 µl de solución buffer. El ADN VTT fue amplificado por semi-nested PCR con cebador específico VTT derivados de dos regiones conservadas de las secuencias publicadas por Okamoto y cols. (21). Para la primera PCR, se usaron los cebadores TT6 (sense: 5'ACAGACAGAGGAGAAGGCAA) y TT7 (antisense: 5'TAC CAYTTAGCTCTCATT, con Y=C y T) (22) para la amplificación del producto de 329 bp. Tras la separación electroforética en gel de agarosa, los sueros que produjeron una sola banda de 267 bp (el tamaño previsto para el fragmento amplificado de ADN-VTT) fueron considerados como positivos.

Método estadístico

Para las variables cualitativas se usó el test estadístico χ2 o el test exacto de Fisher en la unión de dos colas, estimando la "odds ratio" e intervalo de confianza. Para las variables cuantitativas se aplicó el test de Wilcoxon. En todos los tests e intervalos de confianza se consideró un nivel de significación estadística del 95%. Para conocer el efecto independiente de las variables significativas en el análisis univariante se usó la regresión logística exacta. El modelo final fue construido en tres fases, en la primera fue considerado el efecto individual (modelo 0), en la segunda se usaron todas las variable (modelo I) y en la tercera (modelo II) solamente fueron consideradas las variables significativas del modelo previo.

RESULTADOS

La edad gestacional fue de 34,4 ± 4,5 semanas (24-43 semanas) y el peso al nacimiento de 2.195 ± 944 g (550-4.350 g). Un total de 159 (89%) niños recibieron antibióticos, 109 (62%) ventilación mecánica con una duración media de 13 ± 15 días (1-80), 82 (46%) fármacos vasoactivos y 74 (42%) nutrición parenteral durante una media de 25 ± 20 días (2-99). La estancia media en la UCIN fue de 28 ± 28 días (2-180 días) y la hospitalización completa de 38,5 ± 31 días (5-195 días). De los 177 recién nacidos, 129 (73%) fueron transfundidos, recibiendo 461 unidades (U) con una media de 3,6 ± 3 U (1-21 U por paciente).

Pacientes que presentaron aumento de la ALT

La ALT estaba aumentada en 54 (30,5%) pacientes, 46 (36%) transfundidos y 8 (17%) no transfundidos (p < 0,05). En la tabla I se muestran los resultados del análisis univariante y en la tabla II, los resultados y comentarios del análisis multivariante.


Pacientes que presentaron un aumento de la ALT 2,5 veces el valor normal

Sólo 20 (11,3%) niños presentaron un aumento de la ALT 2,5 veces el valor normal: 14% transfundidos y 4% no transfundidos (p = 0,106). En la tabla III se muestra el análisis univariante y en la tabla IV los resultados y comentarios del análisis multivariante.


Pacientes que presentaron aumento de la AST y de la GGT

La AST estaba aumentada en 128 (72%) pacientes (81,7 ± 128 U/l; 95%, IC 59-104 U/l), no había diferencias estadísticamente significativas entre transfundidos 93 (73%) y no transfundidos 36 (73%).

La GGT estaba aumentada en 64 (36%) pacientes (136 ± 146 U/l; 95%, IC 95-176 U/l). El aumento se relacionó con la menor edad gestacional (p < 0,01), con el menor peso al nacimiento (p < 0,05), con los pacientes que presentaron aumento de ALT (p < 0,01), con la HPT (p < 0,05) y en el límite de la significación estadística con la transfusión (p=0,065) y la nutrición parenteral (p = 0,096).

Estudio viral

No se evidenció ninguna infección por VHA, VHB, VHC, herpes, Epstein-Barr. Un niño no transfundido presentó una infección por CMV a los 5 meses de vida con un incremento de ALT de 75 U/l, que persistió durante un mes. El estudio de la madre resultó negativo para el CMV.

El VHG se detectó en 15/177 (9%) neonatos: 14 fueron ARN-VHG positivos y otro paciente se consideró también infectado, aunque el ARN-VHG fue negativo, ya que durante el seguimiento se observó la seroconversión a anti-VHGE2. De ellos 11/129 (9%) fueron transfundidos y 4/48 (8%) no lo fueron, sin que las diferencias fueran estadísticamente significativas.

La figura 1 muestra la epidemiología de la infección por el VHG en los niños transfundidos. Nueve infecciones se produjeron por transmisión parenteral y dos por vía vertical. La tasa de infección por VHG postransfusional fue del 7% (95% IC, 3-13%). Los pacientes con infección postransfusional por VHG recibieron una media de concentrados de hematíes de 6±5 U (1-14 U), mientras que los pacientes transfundidos y VHG negativo recibieron 3 ± 3 U (1-22 U), sin que las diferencias fueran estadísticamente significativas. El riesgo calculado de transmisión del VHG por unidad transfundida fue de 1,96% (95% IC, 1-3,8%). Las madres de los cuatro neonatos no transfundidos que fueron ARN-VHG positivo, resultaron ser positivas para el ARN-VHG (transmisión vertical).

El estudio del anti-VHGE2 efectuado en todos los niños fue negativo en todos ellos, excepto en un niño que fue positivo a los 6 meses y negativo a los nueve. En este caso, la madre presentaba anti-VHGE2 y se consideró que se había producido una transmisión pasiva de anticuerpos.

El curso clínico de la infección por el VHG fue leve (Fig. 2). Catorce RN presentaron aumento de la ALT (93%), pero en sólo 5 (33%) la ALT fue superior a 2,5 veces el valor normal. El pico máximo de ALT fue de 78 ± 46 U/l y la duración media fue de 3 ± 2 meses. Sólo 4 pacientes aclararon el virus a los 18, 36 y 48 meses y en uno se comprobó su seroconversión a anti-VHGE2. Los 11 pacientes restantes permanecieron ARN-VHG positivos aunque la ALT era normal.

El ADN-VTT se estudió en 127 neonatos, de los cuales fue positivo en 39 (31%): 36/109 (33%) transfundidos y 3/16 (17%) no transfundidos, sin diferencias estadísticamente significativas. En el grupo transfundido, hubo 5 casos de transmisión vertical, ya que las madres fueron también positivas. El resto de las madres fueron negativas y se consideró que la vía de transmisión más probable fue la parenteral. En estos casos no se dispuso de suero de los donantes para comprobarlo. Las madres de los 3 casos del grupo no transfundido fueron ADN-VTT positivo y se consideró que la transmisión había sido vertical. En 7 casos se observó coinfección con el VHG.

El curso clínico de la infección VTT fue asintomática, pero16 niños presentaron un aumento de ALT, de los cuales, 6 estaban coinfectados por el VHG. En 8 (50%) el aumento de la ALT fue mayor 2,5 veces el valor normal, 3 de ellos estaban coinfectados por el VHG. El pico máximo de ALT fue de 87 ± 81 U/l y la duración media de 4 ± 3 meses. Sólo dos niños aclararon el virus a los 6 y 18 meses y el resto continuaron positivos, aunque las transaminasas permanecieron normales.

Estudio serológico de las madres

En las madres se demostró que 76 (47%) presentaban anticuerpos anti-CMV-IgG, 46 (28%) anti-VHA-IgG, 39 (25%) anti-EBV-IgG, 27 (17% ) anti-VHs-IgG, 11 (7%) IgG frente toxoplasma, 7 (4%) anti-HBs, 2 (1%) anti-EBV-IgM y un caso (0,6%) anticuerpos anti-CMV-IgM. En los dos últimos casos, no se observó ningún tipo de repercusión sobre sus hijos.

DISCUSIÓN

Por el momento, no se conoce la prevalencia real de la patología postransfusional en el prematuro y en el neonato, por este motivo se analizaron los factores relacionados con el aumento de la ALT. Los pacientes más graves o nacidos con menor peso requieren más días de ingreso en la UCIN, aunque no todos ellos están sometidos a mayor número de intervenciones terapéuticas, incluida la transfusión.

El 70% de los neonatos que ingresaron en la UCIN no presentaron aumento de la ALT. El peso o la edad gestacional no se relacionó con el aumento de la ALT; mientras que la transfusión, el número de unidades transfundidas, la estancia en la UCIN, la duración de la asistencia respiratoria y el tiempo de nutrición parenteral, sí se relacionaron con la elevación de la ALT. La mayoría de los niños graves reciben todas estas intervenciones, pero lo que les diferencia es la duración de las mismas; por ello estas variables están relacionadas entre sí. En cambio, la infección por VHG, el tiempo de nutrición parenteral y el hecho de haber recibido transfusiones tienen un valor independiente en la regresión logística. Póstuma y cols. (23), describieron un aumento transitorio de la FA y de la ALT en el 34% de los recién nacidos después de 4-6 semanas de nutrición parenteral. Otros autores han comunicado la existencia de complicaciones hepáticas en los recién nacidos prematuros y de bajo peso (24-26). En nuestro estudio, los aumentos de la ALT no se relacionaron con el peso ni con el periodo gestacional.

La hepatitis, ampliamente estudiada en el adulto, representa uno de los riesgos de enfermedad postransfusional. El 14% de los niños transfundidos y el 4% de los no transfundidos presentaron un aumento de ALT de 2,5 veces el valor normal. El VHG fue responsable sólo de 5 casos, tres de los cuales estaban coinfectados con el VTT. Lo que significa que este aumento de ALT se debe a otros factores, que podrían estar en relación con la enfermedad de base que motivó el ingreso en la UCIN o con otros virus no identificados transmitidos por la transfusión (27). El incremento de AST fue muy frecuente pero también menos específico. Un dato reseñable fue el número de pacientes que presentaron aumentos de la GGT. Esto fue más frecuente en los prematuros de menor peso, relacionado ello posiblemente con cierto grado de colestasis.

Un hallazgo sorprendente es la elevada prevalencia del VTT (31%). En España, la prevalencia en donantes de sangre sanos es del 14% y del 76% en pacientes con hemofilia (28). La transmisión vertical del VHG y VTT es importante y responsable de la infección en los niños no transfundidos y también de algunos transfundidos; por ello es imprescindible el estudio de las madres y de los donantes para interpretar la importancia de la transfusión como responsable de la transmisión de estos virus. La transmisión vertical del VHG y TTV ha sido demostrada por otros autores (29, 30) y es más frecuente que la del VHC (31).

En conclusión este estudio demuestra la importancia del control de la ALT y GGT en los niños ingresados en UCIN y su seguimiento, ya que están sometidos a múltiples factores que pueden originar lesiones hepáticas. También hay que resaltar la importancia que tiene el estudio viral en los niños, sus madres y donantes. A pesar de que el VHG no se ha relacionado claramente con cuadros de hepatitis en adultos, en los neonatos estudiados puede justificar aumentos de la ALT. Finalmente en la actualidad las transfusiones son seguras para la mayoría de los virus clásicos, pero es posible la transmisión de agentes virales nuevos como el VHG y el VTT, de escasa patogenicidad.

BIBLIOGRAFÍA

1. Corwin HL, Gettinger A, Pearl RG, Fink MP, Levi MM, Shapiro MJ, et al. Efficacy of recombinant human erythropoietin in critically ill patients: A randomized controlled trial. JAMA 2002; 288: 2827-35.        [ Links ]

2. Strauss RG. Erythropoietin and neonatal anemia. N Engl J Med 1994; 330: 1227-8.        [ Links ]

3. Shannon KM, Keith JF, Mentzer WC, Ehrenkranz RA, Brown MS, Widness JA, et al. Recombinant human erithropoietin stimulates erythropoiesis and reduces erythrcyte transfusions in very low birth weight preterm infants. Pediatrics 1995; 95: 1-10.        [ Links ]

4. Strauss RG. Practical issues in neonatal transfusion practice. AJCP 1997; 107 (4) (Supl. 1): S57-63.        [ Links ]

5. Maier RF, Obladen M, Messinger D, Wardrop C. Factors related to transfusion in very low birthweight infants treated with erythropoietin. Arch Dis Child Fetal Neonatal Ed 1996; 74: F182-6.        [ Links ]

6. Ohls RK, Ehrenkranz RA, Wright LL, Lemons JA, Korones SB, Stoll BJ, et al. Effects of early erythropoietin therapy on the transfusion requirements of preterm infants below 1250 grams birth weight: A multicenter, randomized, controlled trial. Pediatrics 2001; 108: 934-42.        [ Links ]

7. Alkalay AL, Galvis S, Ferry DA, Simmons CF, Krueger RC. Hemodynamic changes in anemic premature infants: Are we allowing the hematocrits to fall too low? Pediatrics 2003; 112: 838-45.        [ Links ]

8. Ringer SA, Richardson DK, Sacher RA, Keszler M, Churchill WH. Variations in transfusion practice in Neonatal Intensive Care. Pediatrics 1998; 101: 194-200.        [ Links ]

9. Editorials. Practice variation: Implications for neonatal red blood cell transfusions. J Pediatr 1998; 133: 589-90.        [ Links ]

10. Blajchman MA, Sheridan D, Rawls WE. Risks associated with blood transfusion in newborn infants. Clin Perinatol 1984; 2: 403-15.        [ Links ]

11. Keller KM, Wirth S. Hepatitis C virus (HCV). Low infection rate in premature and full-term neonates following multiple transfusions. Monatsschr Kinderheilkd 1992; 140 (2): 108-12.        [ Links ]

12. González A, Esteban JI, Madoz P, Viladomiu L, Genesca J, Muñiz E, et al. Efficacy of screening donors for antibodies to the hepatitis C virus to prevent transfusion-associated hepatitis: final report of a prospective trial. Hepatology 1995; 22: 439-45.        [ Links ]

13. Salmerón J, Gila A, Oyonarte S, Palacios A, Pérez Ruiz M, Fernández Montoya A, et al. Estudio prospectivo de la incidencia de hepatitis postranfusional después de la exclusión de los donantes anti-VHC ELISA 2 positivos. Med Clin 1995; 105: 641-4.        [ Links ]

14. Barrera JM, Bruguera M, González M, Gálvez A, Castillo R, Rodés J. Eficacia de la exclusión de donantes anti-VHC positivo por ELISA 2 en la prevención de la hepatitis postransfusional. Gastroenterol Hepatol 1996; 19: 240-2.        [ Links ]

15. Salmerón J, Carmona I, Torres C, Muñoz de Rueda P, Gila A, Ruiz-Extremera A. Estudio retrospectivo de la incidencia de infección por el virus de la hepatitis G en los pacientes transfundidos. Med Clin 1999; 112: 409-11.        [ Links ]

16. Torres C, Muñoz de Rueda P, Ruiz-Extremera A, Quintero D, Palacios A Salmerón J. Genomic and antigenomic chains of hepatitis C virus and hepatitis G virus in serum, liver and peripheral blood mononuclear cells. Rev Esp Enferm Dig 2002; 94: 659-63.        [ Links ]

17. Sugiyama K, Goto K, Ando T, Mizutani F, Terabe K, Kawabe Y, et al. Route of TT Virus infection in children. J Med Virol 1999; 59: 204-7.        [ Links ]

18. Okamoto H, Akahane Y, Ukita M, Fukuda M, Tsuda F, Miyakawa Y, et al. Fecal excretion of a nonenveloped DNA virus (TTV) associated with posttransfusion non-A-G hepatitis. J Med Virol 1998; 56 (2): 128-32.        [ Links ]

19. Nishizawa T, Okamoto H, Konishi K, Yoshizawa H, MiyaKawa Y, Mayumi M. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun 1997; 241: 92-7.        [ Links ]

20. Esteban JI, González A, Hernández JM, Viladomiu L, Sánchez C, López-Talavera JC, et al. Evaluation of antibodies to hepatitis C virus in a study of transfusion associated hepatitis. N Engl J Med 1990; 323: 1107-12.        [ Links ]

21. Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Lizuka H, et al. Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown etiology. Hepatology Research 1998; 10: 1-16.        [ Links ]

22. Höhne M, Berg T, Müller AR, Schreier E. Detection of sequeences of TT virus, a novel DNA virus, in german patients. J General Virology 1998; 79: 1-4.        [ Links ]

23. Postuma R, Trevenen CL. Liver disease in infants receiving total parenteral nutrition. Pediatrics 1979; 63: 110-5.        [ Links ]

24. Bell Rl, Ferry GD, Smith EO, Shulman RJ, Christensen BL, Labarthe DR, Wills CA. Total parenteral nutricion-related cholestasis in infants. JPEN 1988; 2: 602-6.        [ Links ]

25. Howell RR. The diagnostic value of serum enzyme measurements. J Pediatr 1996; 68: 121-34.        [ Links ]

26. Brown MR, Thunberg BJ, Goloub L, Maniscalo WM, Cox C, Shapiro DL. Decresed cholestasis with enteral instead of intravenous protein in the very low-birth weight infants. J Pediatr Gastroenterol Nutr 1989; 9: 21-7.        [ Links ]

27. Tanaka Y, Primi E, Wang RY, Umemura T, Yeo AE, Mizokami M, et al. Genomid and molecular evolutionary analysis of a newly identified infectious agent (SEN virus) and its relationship to the TT virus family. J Infect Dis 2001; 183: 359-67.        [ Links ]

28. Puig-Basagoiti F, Cabana M, Guilera M, Giménez-Barcons M, Sirera G, Tural C, et al. Prevalence and route of transmission of infection with a novel DNA virus (TTV), hepatitis C virus, and hepatitis G virus in patients infected with HIV. J Acquir Immune Defic Syndr 2000; 23 (1): 89-94.        [ Links ]

29. Feucht HH, Zölner B, Polywka S, Laufs R. Vertical transmision of hepatitis G. Lancet 1996; 347: 615-6.        [ Links ]

30. Davidson F, MacDonald D, Mokili JL, Prescott LE, Graham S, Simmonds P, et al. Early acquisition of TT virus (TTV) in an area endemic for TTV infection. J Infect Dis 1999; 179 (5): 1070-6.        [ Links ]

31. Ruiz-Extremera A, Salmerón J, Torres C, De Rueda PM, Giménez F, Robles C, et al. Follow-up of transmission of hepatitis C to babies of human immunodeficiency virus-negative women: the role of breast-feeding in transmission. Pediatr Infect Dis J 2000; 19 (6): 511-6.        [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons