SciELO - Scientific Electronic Library Online

 
vol.104 issue11Genes and populations in susceptibility to celiac diseaseColorectal cancer survival: Results from a hospital-based cancer registry author indexsubject indexarticles search
Home Pagealphabetic serial listing  

My SciELO

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista Española de Enfermedades Digestivas

Print version ISSN 1130-0108

Rev. esp. enferm. dig. vol.104 n.11 Madrid Dec. 2012

http://dx.doi.org/10.4321/S1130-01082012001100003 

TRABAJOS ORIGINALES

 

Frecuencia de polimorfismos del gen MYO9B en pacientes celiacos y en sujetos controles

Frequency of MYO9B polymorphisms in celiac patients and controls

 

 

Tamara Loeff1,2, Magdalena Araya1 y Francisco Pérez-Bravo2

1 Instituto de Nutrición y Tecnología de los Alimentos (INTA). Universidad de Chile.
2 Laboratorio de Genómica Nutricional. Departamento de Nutrición. Facultad de Medicina. Universidad de Chile. Chile

La investigación, que fue motivo de la tesis de Magíster de Tamara Loeff, fue financiada a través de los proyectos FONDECYT No 1100075 y CINUT.

Dirección para correspondencia

 

 


RESUMEN

Introducción: el gen miosina IX B (MYO9B) participa en el mantenimiento de la barrera intestinal y se postula que puede aportar riesgo para desarrollar enfermedad celiaca (EC). El objetivo de este estudio fue comparar la frecuencia y la asociación de los polimorfismos rs 2305764, rs 2305767 y rs 1457092 del gen MYO9B en pacientes pediátricos con EC procedentes de Chile y Argentina.
Pacientes y métodos: el estudio se realizó en 104 pacientes pediátricos con EC (chilenos y argentinos) y en 104 sujetos controles. El análisis de los polimorfismos del gen MYO9B se realizó mediante ensayos Taqman de discriminación alélica. Se evalúo equilibrio de Hardy-Weinberg mediante Chi-cuadrado y comparación de haplotipos según prueba de Fisher.
Resultados: los polimorfismos de un solo nucleótido (SNPs) rs2305767 y rs1457092 mostraron asociación con la EC. El genotipo TT del rs2305767 sería un factor protector (p < 0,0001, OR = 0,19 IC 0,1-0,4) mientras que el genotipo CT sería un factor de riesgo (p < 0,0001, OR = 4,9 IC 2,2-11,3). En el rs1457092, el genotipo CC resultó también un factor protector frente a esta enfermedad (p < 0,0001, OR = 0,07 IC 0,0-0,3).
Conclusión: nuestros hallazgos sugieren que la variación genética del gen MYO9B estaría asociada a la EC en este grupo de pacientes, constituyendo un factor tanto de protección como a susceptibilidad dependiendo del polimorfismo en cuestión.

Palabras clave: Gen MYO9B. Enfermedad celiaca. Haplotipos.


ABSTRACT

Introduction: the MYO9B gene contributes to the maintenance of the intestinal barrier and it has been postulated as a risk factor of celiac disease (CD). The objective of this study was to compare the frequency and association rs2305764, rs2305767and rs1457092 MYO09B polymorphisms in pediatric CD patients from Chile and Argentina.
Patients and methods: the study was made in 104 CD pediatric patients (Chilean and Argentineans) and 104 controls subjects. MYO9B gene polymorphisms were analyzed by Taqman allelic probes. We evaluated the Hardy-Weinberg equilibrium by means of Chi-square and compared the haplotypes distribution using Fisher test.
Results: SNPs rs2305767 and rs1457092 were associated with celiac disease (CD); TT genotype in rs2305767 would be a protective factor (p < 0.000, OR = 0.19 CI 0.1-0.4) and the CT genotype would be a risk factor (p < 0.0001, OR = 4.9 CI 2.2 to 11.3). CC genotype in rs1457092 also showed a protective effect for celiac (p < 0.000, OR = 0.07 CI 0.0 to 0.3).
Conclusion: our findings suggest that genetic variation MYO9B gene is associated with CD, as a protective or a risk factor depending on the polymorphism studied.

Key words: MYO9B gene. Celiac disease. Haplotypes.


Abreviaturas
MYO9B: miosina IX B.
SNP: polimorfismo de un solo nucleótido.
EC: enfermedad celiaca.
HLA: antígeno leucocitario humano.
ELISA: ensayo por inmunoabsorción ligado a enzima.
DNA: ácido desoxirribonucleico.
PCR-RT: "real time quantitative polymerase reaction".
χ2: Chi2.
OR: Odds ratio.

 

Introducción

La enfermedad celiaca (EC) es un desorden autoinmune crónico que resulta de la interacción de ciertos genes que determinan la susceptibilidad, el ambiente que aporta el gluten y un sistema efector, el aparato inmunológico. Tras atravesar el epitelio, esta proteína induce un proceso inflamatorio crónico, con compromiso variable del intestino delgado (1). Su prevalencia a nivel mundial está alrededor del 1% en la mayoría de las poblaciones, sin diferencias geográficas, étnicas, ni raciales (2); habiéndose producido un gran aumento de pacientes diagnosticados en la última década, debido en buena parte a la aparición y uso generalizado de nuevas herramientas de pesquisa de la enfermedad, los auto anticuerpos antiendomisio y antitransglutaminasa, de alta sensibilidad y especificidad (3), que ayudan a la toma de decisión de cuando realizar la biopsia intestinal.

La enfermedad es poligénica e involucra, principalmente, genes del complejo mayor de histocompatibilidad clase II; la conformación HLA DQ2 y HLA DQ8 explicaría alrededor del 50% de la enfermedad (4); una serie de genes "candidatos" no HLA y fenómenos epigenéticos explicarían el porcentaje restante (3,5). Se ha postulado que la presencia de estos genes explicarían el porqué sujetos portadores de HLA DQ2/DQ8 desarrollan la EC a lo largo de su vida. Los individuos homocigotos para estos genes HLA, presentan al menos 5 veces mayor riesgo de desarrollar la enfermedad que los heterocigotos (6). Sin embargo, alrededor del 30% de la población es portadora de estas conformaciones y no desarrollan EC, lo que indica que su presencia sería necesaria, pero no suficiente para el desarrollo de la enfermedad. Qué genes no-HLA y los mecanismos con que operan para influir en la enfermedad, no están claros aún. Se han descrito regiones génicas asociadas a la EC en los cromosomas 2, 5, 6, 9, 15 y 19. Actualmente, se reconocen cuatro regiones de susceptibilidad que incluyen CELIAC1 (6p 21.3), portadora de los genes HLA DQ2-8, CELIAC2, portadora de un importante locus de riesgo para EC (5q 31-q33); Esta región ha sido también asociada a otros desordenes inflamatorios, aún la asociación con el gen no está del todo clara. CELIAC3 (2q33), donde se ubica el gen CTL4 y CELIAC4 (19p 13.1) que contiene el gen MYO9B (7). Aunque se han propuesto polimorfismos específicos asociados a la aparición de EC, no es claro el papel que juega cada uno de estos genes en la patogénesis de la enfermedad. CD28-CTLA4-ICOS se localiza en el cromosoma 2q33 y se asocia a linfocitos T citotóxicos; tendría un rol en la mantención de la tolerancia inmunológica a antígenos propios (8). El antígeno 4 de linfocito T citotóxico proporcionaría una señal co-estimuladora esencial para el inicio y progresión de la respuesta de células T, postulándose que su función sería apagar estas células, previamente activadas. La hipótesis actual postula que al bloquear la activación de las células T por Antígeno 4 de linfocito T citotóxico, se impediría que continúe la cadena de reacciones asociadas a esas células T; el polimorfismo sería funcional y abortaría la regulación negativa celular (9).

Los mecanismos de señalización celular son determinantes fundamentales en la coordinación y las funciones de los distintos tipos celulares. Las vías de señalización están interconectadas y forman redes complejas con múltiples elementos que se interconectan entre sí. En las últimas décadas se han descrito vías y elementos involucrados en la señalización celular, entre los cuales se encuentran las proteínas Rho GTPasas. Estas proteínas Rho forman una de las subfamilias de la superfamilia Ras de GTPasas. La subfamilia Rho en mamíferos está formada por varios miembros: uno de ellos es RhoA. Una de las principales características de las proteínas Rho, como de todas las proteínas G, es que unen nucleótidos de guanina y ciclan entre un estado inactivo unidas a GDP y un estado activo unidas a GTP, estas proteínas tienen actividad GTPasa endógena, pudiendo hidrolizar el GTP a GDP en un proceso dependiente de Mg2+. Se asume que las proteínas de la superfamilia Ras se activan para interaccionar con sus efectores cuando se encuentran unidas a GTP, los cuales a su vez interactúan con otras proteínas produciendo una cascada de señalización.

La gran variedad de funciones biológicas de los distintos miembros de la familia de las Rho GTPasas está dada por la unión a distintos efectores celulares. Cuando la familia Rho se une por ejemplo, a la proteína efectora ROCK realiza la función de regular la miosina y el citoesqueleto de actina (10).

Recientemente, se ha descrito el gen de la miosina (MYO9B) en el cromosoma 19 (intron 28) (11-13), el cual codifica para una molécula no convencional de miosina que cumple la función de remodelar la actina en los enterocitos epiteliales. Es un gen motor, con una cabeza única de miosina que debido a su dominio de actina es capaz de unirse a filamentos de actina en las células y moverse a lo largo de ellas.

MYO9B tendría la capacidad de activar el dominio de la proteína GTPasa (Rho-GAP), la cual regula la familia Rho GTPasas. La función de esta familia de proteínas es regular el ensamblaje de las uniones estrechas ("tight junction") y mantener la selectividad de la vía paracelular en los enterocitos. Un RhoA más activo regula negativamente las uniones estrechas resultando en un aumento de la permeabilidad epitelial paracelular, mientras que una forma más inactiva disminuye la permeabilidad; así, RhoA sería importante en el equilibrio de las funciones de protección y barrera selectiva (14). La alteración de la barrera intestinal permitiría que péptidos del gluten accedan a la región subepitelial donde la presentación del antígeno mediada por HLA DQ2/ DQ8 iniciaría la respuesta inflamatoria. Se ha descrito que la presencia de polimorfismos del gen MYO9B confiere odds ratios para el desarrollo de la EC de 1,7 (heterocigotos) y 2,3 (homocigotos) (11). Este gen también se ha descrito en desórdenes inflamatorios intestinales especialmente en colitis ulcerosa, donde podría actuar a través del mismo mecanismo, favoreciendo la insuficiencia de la barrera intestinal (14). El objetivo de esta investigación fue estimar la frecuencia y asociación de los polimorfismos del gen MYO9B (rs 2305764, rs 2305767 y rs 1457092) en pacientes celiacos (casos) e individuos sanos (controles).

 

Materiales y métodos

Sujetos

El diseño corresponde a un estudio caso-control, y fue llevado a cabo en un total de 208 pacientes y controles pediátricos de los cuales 104 fueron pacientes con EC y 104 controles sanos. De los 104 niños con EC, 50 eran de nacionalidad Chilena (edad promedio 14 ± 15,4 años) y 54 provenían de Argentina (edad promedio (7,5 ± 7,1 años). En tanto, los 104 controles fueron de nacionalidad chilena. Los pacientes chilenos, fueron reclutados en Santiago, en los Hospitales San Juan de Dios, Excequiel González Cortés, Militar y Pontificia Universidad Católica, en tanto los argentinos fueron reclutados en la ciudad de Resistencia, Provincia del Chaco. La inclusión de pacientes argentinos y chilenos se basó en estudios previos que demostraron que los haplotipos HLA de riesgo para EC y la frecuencia de genes nativos en esta región de Argentina y la región metropolitana de Santiago no son distintos (15). El diagnóstico se hizo siguiendo los siguientes criterios: presencia de al menos un anticuerpo positivo (antitransglutaminasa y/o antiendomisio), una biopsia que mostró histología compatible con la enfermedad, y mejoría clínica al instaurar la dieta libre de gluten (16,17). Se definió como control sano a aquellos sujetos que fueron contactados en colegios de diferentes comunas de la región metropolitana; presentaban ausencia de historia familiar y personal de EC u otra patología autoinmune (investigada mediante una encuesta dirigida), eran asintomáticos, presentaban anticuerpos antiendomisio y antitransglutaminasa negativos y tenían valores normales de inmunoglobulina A. Individuos aparentemente asintomáticos en los que se detectó cualquier síntoma gastrointestinal sin causa aparente, por leve que fuera, se excluyó del estudio. Esta investigación contó con la aprobación del Comité de Ética del Instituto de Nutrición y Tecnología de los Alimentos. Los niños menores de diez años se incluyeron en el estudio previa firma del consentimiento informado por parte de sus padres o tutores. Para niños mayores de diez años, se solicitó además del consentimiento informado firmado por uno de sus padres, la firma de un asentimiento previo a su incorporación al protocolo.

Procedimientos

Se extrajo una muestra de 12 ml de sangre de la vena anticubital, en la que se cuantificaron los anticuerpos antiendomisio y antitransglutaminasa y se extrajo el DNA genómico. Se obtuvieron datos clínicos de la ficha y de los propios sujetos de estudio. Desgraciadamente, en numerosos casos la información registrada era incompleta, por lo que no fue posible analizar la potencial relación entre presentación clínica y presencia de polimorfismos y/o HLA.

Análisis genético

El DNA genómico se extrajo a partir de sangre total congelada, a través de técnicas estándares. La integridad del DNA se analizó por electroforesis en un gel de agarosa al 1%, teñido con bromuro de etidio. Se midió la concentración del DNA utilizando el equipo de cuantificación NANODROP (Thermo Fisher Scientific, USA). El estudio de polimorfismos se realizó a través de sondas Taqman, para los polimorfismos rs2305767 C/T, rs1457092 A/C y rs2305764 A/G (11,18-21) del gen de la miosina. Los polimorfismos fueron determinados mediante PCR en tiempo real (Agilent Technologies Stratagene Mx 3000p). Para ello, se amplificó la región polimórfica del gen MYO9B, a través de ensayos utilizando las siguientes sondas Taqman de discriminación alélica: C_1654927_20, C_1654895_10, y C_1654873_1 (Aplied Biosystems, Foster City, CA). El protocolo de amplificación para la PCR que se utilizó fue el siguiente: denaturación inicial a 95 o C durante 10 minutos seguido de 40 ciclos que consisten en denaturación a 92o C durante 15 segundos, "annealing"/extensión a 60 o C durante 1 minuto (22). Las sondas utilizadas correspondieron a las siguientes secuencias:

- rs2305764: ACACGTGTGAGTGTGTTTTTCCCCC [A/G] GCATATACGGAGCCGTAGTCTTGAA.

- rs2305767: GTCAGTTCCTCCATAGCAAGCCCCG [C/T] TGGATGCACGTCCCACCCTGTAGAT.

- rs1457092: GCATCCACCGGGCACAGAGAAGCCC [A/C] CAGGAGGATATCAGCAGCTCCCGTC.

Tamaño muestral y análisis estadístico

Para el cálculo del tamaño muestral se utilizó una potencia de un 80% y un nivel de significación de 5%, considerando las máximas diferencias encontradas entre las frecuencias alélicas. Se utilizó la mayor frecuencia alélica de los controles (0,5) y menor frecuencia alélica de los celiacos (0,3) según Wolters y cols. (18). El número de tamaño de muestra obtenido fue de 104.

El análisis de datos incluyó la descripción porcentual de la frecuencia de polimorfismos del gen MYO9B (rs2305767, rs1457092 y rs2305764). Se utilizó el test de independencia χ2 para comparar proporciones y determinar asociación de frecuencias alélicas y genotípicas entre casos y controles. Y también para asociar los polimorfismos con características clínicas e inmunológicas de la enfermedad. La medición de riesgo para los polimorfismos del gen MYO9B (rs2305767, rs1457092 y rs2305764) se hizo mediante cálculo de razón de riesgo ("odd ratio"). Se utilizó el modelo de regresión logística para evaluar la asociación de los polimorfismos con la EC. Los valores fueron considerados significativos cuando p < 0,05. Los datos fueron analizados utilizando el paquete estadístico STATA versión 10.0 (Stata Statistical Software 1984-2009). StataCorp LP, Texas, USA. Las comparaciones de haplotipos fueron analizadas mediantes las pruebas χ2 y prueba exacta de Fisher utilizando el programa Shesis (URL: http://202.120.7.14/Analysis.php). Se evaluó la concordancia de las frecuencias genotípicas con respecto al equilibrio de Hardy-Weinberg mediante la prueba exacta de χ2.

 

Resultados

Las muestras se analizaron inicialmente según el país de origen; no se demostraron diferencias significativas en los datos clínicos ni genéticos por lo que los resultados se presentan en conjunto. La tabla I resume la información de los HLA de riesgo para EC en pacientes chilenos y argentinos, comparados con el grupo control. En ella se puede observar que, no hay diferencias estadísticamente significativas, cuando se comparan las frecuencias de alelos de riesgo HLA (DQ2/DQ8) en ambos grupos de celiacos. Al momento del estudio la edad promedio de los celiacos fue de 11,1 años (DS ± 12,7 años) y la de los controles 15,9 años (DS ± 12,3 años). La edad de diagnóstico estuvo entre los 7,5 y los 14 años. La distribución por sexo fue similar entre casos y controles, 65 y 66 mujeres en los casos y controles, respectivamente.

 

 

La distribución del polimorfismo rs2305764 fue similar entre casos y controles, sin que se demostrara asociación de alguno de los genotipos con EC (valor p > 0,05). En el polimorfismo rs2305767, se encontró asociación con la EC para los genotipos TT y CT, obteniéndose un OR de 0,19 [IC 0,1-0,4] para el genotipo TT, que sugiere un posible efecto protector de EC. Para el genotipo CT se obtuvo un OR de 4,9 [IC 2,2-11,3], que sugiere que sería un factor de susceptibilidad de EC. Para el polimorfismo rs1457092 se encontró que solo el genotipo CC se asoció a EC, con un OR de 0,7 [IC 0,0-0,3], lo cual se interpreta como posible efecto protector contra la EC. Solo el polimorfismo rs1457092 presentó equilibrio de Hardy Weinberg en los controles (Tabla II).

 

 

El análisis de los genotipos utilizando un modelo de distribución recesivo, mostró que solo el polimorfismo rs2305767 se asociaría con la EC (Tabla III). Este genotipo obtuvo un OR 0,19 [IC 0,07-0,4], que sugiere un posible efecto protector para el desarrollo de EC.

 

Finalmente, el análisis de los haplotipos más frecuentes para los tres polimorfismos estudiados reveló una alta frecuencia de los haplotipos ATA (39%) y CGG (25%) en los pacientes celiacos respecto de los controles (p = 0,006, OR = 1,78 [IC 1,2-2,7] y OR = 2,01[IC 1,2-3,3]). En contraste los haplotipos GCA (17%) y GTC (12%) fueron más frecuentes en la población control en relación a los casos (p = 0,033, OR = 0,53 [IC 0,3-0,9] y p = 0,02 OR = 0,44 [IC 0,2-0,9] respectivamente) (Tabla IV).

 

 

Discusión

En las condiciones de este estudio, el polimorfismo rs2305764 no se asoció a la EC en ninguno de sus genotipos mientras que los polimorfismos rs2305767 y rs1457092 sí lo hicieron, los genotipos TT como factor protector y el genotipo CT como factor de riesgo del polimorfismo rs2305767. El genotipo CC del polimorfismo rs1457092 sería también un factor protector frente a la enfermedad. Estos resultados sugieren que en el tipo de individuos estudiados los polimorfismos del gen MYO9B se asocian tanto a protección como a susceptibilidad para EC, dependiendo del polimorfismo en cuestión.

En Chile, la EC tiene una prevalencia de alrededor de 1% según datos aportados por la última Encuesta Nacional de Salud (23). Se estima que existe un gran sub-diagnóstico de la enfermedad en el país, ya que sólo el 10% de las personas que se estima debieran ser celiacos en la población, son diagnosticadas (6). No hay estudios en el país ni la región que ilustren el papel que puedan jugar los polimorfismos estudiados, que podrían permitir la mejor comprensión de la enfermedad.

MYO9B es uno de los genes más recientemente descritos en asociación con EC por su participación en la mantención de la calidad de la barrera intestinal. La revisión de la literatura que hicimos no reveló datos publicados sobre los polimorfismos de este gen MYO9B en población latinoamericana. Nuestros resultados muestran diferencias al compararlos a dos de los estudios publicados en Europa. Ninguno de los genotipos del polimorfismo rs2305764 se asoció a EC, situación que difiere de lo descrito por Sánchez y cols. (22), que encontraron que el genotipo AA de este polimorfismo se asoció a EC con un OR 2,3 [IC 1,3-4,2] p = 0,01. De igual forma, el estudio de Monsuur y cols, asoció este mismo genotipo a un OR 1,66 [IC 1,23-2,13] p = 0,00053 en los heterocigotos y un OR 2,27 [IC 1,56-3,30] p = 0,00155 para los homocigotos (11). Datos publicados recientemente muestran varios estudios que no muestran asociación entre este polimorfismo y EC (12,20,21,24-27).

En el polimorfismo rs2305767, encontramos que el genotipo CT mostró asociación con EC con un OR de 4,9 [IC 2,2-11,3] p = 0,001, en tanto que el genotipo TT mostró un rol protector de la enfermedad OR 0,19 [IC 0,1-0,4] p = 0,0001. En el estudio de Sánchez y cols. (21), este polimorfismo se asoció a la EC con un OR 1,5 [IC 1,0-2,0] p = 0,03. En el estudio de Monsuur y cols. (10) también hubo asociación de este polimorfismo con EC.

En el análisis del polimorfismo rs1457092, el genotipo CC se asoció a EC como factor protector, con un OR 0,07 [0,0-0,3] p = 0,0001, lo que es semejante a lo encontrado en el estudio de Monsuur y cols. (10), pero no en el de Sánchez (21). Estas semejanzas y diferencias entre unos y otros conjuntos humanos evaluados ponen en relieve la variabilidad genética de la población a nivel global. Es clara la necesidad de contar con más estudios para entender mejor porqué se producen y cuál es la relación con la EC. El equilibrio de Hardy-Weinberg sólo se observó en los controles para el polimorfismo rs1457092. Sin embargo creemos que la muestra es representativa de nuestra población y no hay sesgo por estratificación; los casos estudiados respetaron el tamaño muestral calculado; aún así, los autores reconocen que es probable que el tamaño muestral utilizado esté al límite de lo aceptable debido a que se utilizó una potencia de un 80%. Creemos que factores como el sesgo de selección podría estar controlado dado que los pacientes y controles derivan de diferentes fuentes. Sin embargo el exceso de heterocigotos observado para los polimorfismos rs2305764 y rs2305767 podría asociarse a una errónea asignación de alelos, no obstante en el protocolo de discriminación alélica no se utilizó un estándar y todas las muestras fueron consideradas como desconocidas.

La distribución de genotipos mostró que solo el polimorfismo rs2305767 se asociaría con la EC (Tabla III). Poseer este polimorfismo otorgaría un factor protector para el desarrollo de EC. El análisis de haplotipos (Tabla IV) mostró dos posibles combinaciones de riesgo para EC y estas correspondieron a los haplotipos ATA y GCC; ellos abarcan el 64% de las posibles combinaciones y otorgan un OR de 1,78 y 2,01 respectivamente. Además se observaron dos combinaciones haplotípicas consideradas como protectoras GCA y GTC cuyos OR fueron 0,53 y 0,44 respectivamente.

 

Agradecimientos

Los autores agradecen a los gastroenterólogos del Hospital Militar, San Juan de Dios, Exequiel Gonzales Cortés y Pontificia Universidad Católica y a la Dra. Alejandra Parada, así mismo como a las Dras. Patricia Motta y Graciela Martin, quienes dieron acceso a los pacientes celiacos que participaron en este estudio.

 

 

Dirección para correspondencia:
Francisco Pérez-Bravo.
Laboratorio de Genómica Nutricional.
Departamento de Nutrición.
Facultad de Medicina. Universidad de Chile.
Avda. Independencia No 1027,
Comuna de Independencia. Santiago, Chile.
e-mail: fperez@med.uchile.cl

Recibido: 28-05-2012
Aceptado: 29-10-2012

 

 

Bibliografía

1. Parada A, Araya M. El gluten. Su historia y efectos en la enfermedad celiaca. Rev Méd Chile 2010;138:1319-25.         [ Links ]

2. Sáez L, Pérez I. Adult celiac disease - a common, significant health problem worldwide. Rev Esp Enferm Dig 2010;102:461-5.         [ Links ]

3. Leeds J, Hopper A, Sanders D. Coeliac disease. Br Med Bull 2008;88:157-70.         [ Links ]

4. Sperandeo M, Tosco A, Izzo V, Tucci F, Troncone R, Auricchio R, et al. Potential Celiac Patients: A Model of Celiac Disease Pathogenesis. PLoS One 2011;6:e21281.         [ Links ]

5. Lammers K, Ruliang M, Brownley J, Lu B, Gerard C, Thomas K, et al. Gliadin induces an increase in intestinal permeability and zonulin release by binding to the chemokine receptor CXCR3. Gastroenterology 2008;135:194-204.         [ Links ]

6. Herrera M, Hermoso M, Quera R. Enfermedad celiaca y su patogenia. Rev Med Chile 2009;137:1617-26.         [ Links ]

7. Fundia A, Larripa I, Slavutsky I. Alteraciones genéticas, inestabilidad genómica y cáncer en enfermedad celiaca. Acta Gatroenterológica Latinoamericana 2009;39:55-62.         [ Links ]

8. Gudjónsdóttir A, Nilsson S, Torinsson A, Ek J, Amundsen J, Wahlstrom J, et al. Association between genotypes and phenotypes in coeliac disease. J Pediatr Gastroenterol Nut 2009;49:165-9.         [ Links ]

9. Kristiansen O, Larsen Z, Pociot F. CTLA-4 in autoimmune diseases - a general susceptibility gene to autoimmunity? Genes Immun 2000;1:170-84.         [ Links ]

10. Lorenzano P, Cardama G, Comin M, Alonso D, Gómez D. Rho GTPasas como blancos terapéuticos relevantes en cáncer y otras enfermedades humanas. Medicina 2010;70:555-64.         [ Links ]

11. Monsuur A, Bakker P, Alizadeh B, Zhernakova A, Bevova M, Strengman E, et al. Myosin IXB variant increases the risk of celiac disease and point toward a primary intestinal barrier defect. Nat Genet 2005;37:1341-4.         [ Links ]

12. Hunt K, Monsuur A, McArdle W, Kumar P, Travis S, Walters J, et al. Lack of association of MYO9B genetic variants with coeliac disease in a British cohort. Gut 2006;55:969-72.         [ Links ]

13. Hanley P, Xu Y, Kronlage M, Grobe K, Schon P, Song J, et al. Motorized RhoGAP myosin IXb (Myo9b) controls cell shape and motility. PNAS 2010;107:12145-50.         [ Links ]

14. Monsuur A, Wijmenga C. Understanding the molecular basis of celiac disease: What genetic studies reveal. Ann Med 2006;38:578-91.         [ Links ]

15. Parada A, Araya M, Pérez-Bravo F, Méndez M, Mimbacas A, Motta P, et al. Amerindian mtDNA haplogroups and celiac disease risk HLA haplotypes in mixed-blood Latin American patients. J Pediatr Gastroenterol Nut 2011;53:429-34.         [ Links ]

16. Walker-Smith J, Guandalini S, Schmitz J, Shmerling D, Visakorpi J. Revised criteria for diagnosis of coeliac disease. Arch Dis Child 1990;65:909-11.         [ Links ]

17. Ribes-Koninckx C, Mearin M, Korponay-Szabó IR, Shamir R, Husby S, Ventura A, et al. Coeliac disease diagnosis: ESPGHAN 1990 criteria or need for a change? Results of a questionnaire. J Pediatr Gastroenterol Nutr 2012;54:15-9.         [ Links ]

18. Wolters V, Verbeek W, Zhernakova A, Onland-Moret C, Schreurs M, Monsuur A, et al. The MYO9B gene is a strong risk factor for developing refractory celiac disease. Clin Gastroenterol Hepatol 2007;5:1399-405.         [ Links ]

19. Persengiev S, Koeleman B, Downes K, Valdigem G, Van der Slik A, Eerligh P, et al. Association analysis of myosin IXB and type 1 diabetes. Hum Immunol 2010; 71: 598-601.         [ Links ]

20. Núñez C, Márquez A, Varadé J, Martínez A, Polanco I, Maluenda C, et al. No evidence of association of the MYO9B polymorphisms with celiac disease in the Spanish population. Tissue Antigens 2006;68:489-92.         [ Links ]

21. Cirillo G, Di Domenico M, Corsi I, Gagliardo T, del Giudice E, Perrone L, et al. Do MYO9B genetic variants predispose to coeliac disease? An association study in a cohort of South Italian children. Dig Liver Dis 2007;39:228-31.         [ Links ]

22. Sánchez E, Alizadeh B, Valdigem G, Ortego-Centeno N, Jiménez-Alonso J, de Ramón E, et al. MYO9B gene polymorphisms are associated with autoimmune diseases in Spanish population. Hum Immunol 2007;68:610-5.         [ Links ]

23. MINSAL, Segunda Encuesta Nacional de Salud. 2009-2010:783-7.         [ Links ]

24. Giordano M, Marano C, Mellai M, Limongelli MG, Bolognesi E, Clerget-Darpoux F, et al. A family-based study does not confirm the association of MYO9B with celiac disease in the Italian population. Genes Immun 2006;7:606-8.         [ Links ]

25. Koskinen L, Korponay-Szabo I, Viiri K, Juuti-Uusitalo K, Kaukinen K, Lindfors K, et al. Myosin IXB gene region and gluten intolerance: linkage to coeliac disease and a putative dermatitis herpetiformis association. J Med Genet 2008;45:222-7.         [ Links ]

26. Amundsen S, Vatn M, Wijmenda C, Sollid L, Lie B. Association analysis of MYO9B gene polymorphisms and inflammatory bowel disease in Norwegian cohort. Tissue Antigens 2006;68:249-52.         [ Links ]

27. Latiano A, Mora B, Bonamico M, Megiorni F, Mazzilli M, Cucchiara S, et al. Analysis of candidate genes on chromosomes 5q and 19p in celiac disease. J Pediatr Gastroenterol Nutr 2007;45:180-6.         [ Links ]

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License