SciELO - Scientific Electronic Library Online

 
vol.7 número1Trabecular Bone Score y tratamiento quirúrgico del hiperparatiroidismo primarioMelorreostosis: presentación de un caso clínico índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Em processo de indexaçãoCitado por Google
  • Não possue artigos similaresSimilares em SciELO
  • Em processo de indexaçãoSimilares em Google

Compartilhar


Revista de Osteoporosis y Metabolismo Mineral

versão On-line ISSN 2173-2345versão impressa ISSN 1889-836X

Rev Osteoporos Metab Miner vol.7 no.1 Madrid Jan./Mar. 2015

http://dx.doi.org/10.4321/S1889-836X2015000100002 

 

 

Polimorfismo A986S del receptor sensor del calcio y fracturas clínicas osteoporóticas

A986S polymorphism of calcium-sensing receptor and osteoporotic clinical fractures

 

 

Briongos-Figuero L.S., Abad-Manteca L., Cuadrado-Medina F., Pineda-Alonso M., Vega-Tejedor G., Pérez-Castrillón J.L.

Servicio de Medicina Interna - Hospital Universitario del Río Hortega - Valladolid

Dirección para correspondencia

 

 


RESUMEN

Introducción: La relación entre osteoporosis e hipertensión arterial no está claramente establecida, habiéndose descrito en ésta última alteraciones del metabolismo del calcio que podrían explicar su asociación. Nuestro objetivo fue establecer la relación entre el polimorfismo A986S del receptor sensor del calcio (CaSR) y la presencia de fracturas clínicas osteoporóticas en un grupo de pacientes hipertensos.
Material: Estudio de cohortes prospectivo observacional en 71 pacientes hipertensos, desde 2001 hasta junio de 2014. Obtuvimos datos sociodemográficos y clínicos, incluyendo fracturas osteoporóticas clínicas. El polimorfismo del CaSR se analizó con técnicas moleculares. Analizamos los datos con SPSS 15.0 (p<0,5).
Resultados: El 43,7% de los pacientes eran varones y el 56,3% mujeres. El genotipo AA se encontró en el 67,6%, el SS en el 2,8% y el AS en el 29,6%. Aquéllos con genotipo AA no presentaban más comorbilidad (27% vs. 26%, p=0,9) ni fracturas patológicas (14,6% vs. 21,7%, p=0,4) que el resto. En el subgrupo de mujeres se recogieron 11 fracturas osteoporóticas clínicas, sin encontrar diferencias entre el genotipo AA y el resto (28% vs. 27%, p=0,9).
Conclusiones: No hemos encontrado asociación entre el polimorfismo A986S y la presencia de fracturas osteoporóticas clínicas en nuestra cohorte.

Palabras clave: osteoporosis, hipertensión, receptor sensor del calcio, riesgo de fractura.


SUMMARY

Introduction: The relationship between osteoporosis and arterial hypertension has not been clearly established, with alterations in calcium metabolism having been reported in the latter which may explain their association. Our objective was to establish the relationship between the A986S polymorphism of the calcium-sensing receptor (CaSR) and the presence of osteoporotic clinical fractures in a group of patients with hypertension.
Material: Prospective observational cohort study in 71 patients with hypertension, from 2001 to June 2014. We obtained socio-demographic and clinical data, including osteoporotic clinical fractures. The CaSR polymorphism was analysed using molecular techniques. The data was analysed using SPSS 15.0 (p<0.5)
Results: 43.77% of the patients were men and 56.3% women. Genotype AA was found in 67.6% of patients, genotype SS in 2.8% and genotype AS in 29.6%. Those with genotype AA did not have higher comorbidity (27% vs 26%, p=0.9) or more pathological fractures (14.6% vs 21.7%, p=0.4) than the others. In the subgroup of women, 11 osteoporotic clinical fractures were recorded, without there being any differences between those with the AA genotype and the others (28% vs 27%, p=0.9).
Conclusions: We found no association between the A986S polymorphism and the presence of osteoporotic clinical fractures in our cohort.

Key words: osteoporosis, hypertension, calcium-sensing receptor, risk of fracture.


 

Introducción

La osteoporosis y la hipertensión arterial (HTA) son entidades con alta prevalencia en la población general, ambas clínicamente silentes que se hacen sintomáticas cuando aparecen complicaciones, tales como fracturas y enfermedades cardiovasculares. Estudios recientes sugieren que la HTA es un factor de riesgo para la aparición de fracturas patológicas [1,2]. Así, en los pacientes hipertensos se han descrito diversas alteraciones del metabolismo del calcio, como descenso del calcio iónico y aumento de la PTH y de la calciuria, aunque sólo ésta última se ha asociado al descenso de la masa ósea [3-5].

El receptor sensor del calcio (CaSR) está acoplado a proteínas G y detecta los niveles extracelulares de calcio. Se expresa en diversos tipos celulares (riñón, hueso -tanto en osteoblastos como en osteoclastos-, cerebro), aunque es en las células paratiroideas donde existe mayor densidad. De este modo, el CaSR juega un papel fundamental en la homeostasis del calcio, regulando el eje calcio-hormona paratiroidea (PTH)-vitamina D. Por otro lado, el CaSR controla la excreción y reabsorción de calcio en el asa ascendente de Henle actuando en diferentes transportadores e interviniendo también en la regulación de la presión arterial [6-9].

El polimorfismo del codón 986 (A986S) del CaSR se asocia con un incremento de calcio sérico y un descenso de la calciuria, datos antagónicos a los observados en la hipertensión arterial. Por ello, el objetivo de nuestro estudio fue determinar si la presencia del alelo S del polimorfismo A986S del CaSR, podía ejercer un efecto protector sobre la aparición de fracturas osteoporóticas clínicas en un grupo de pacientes hipertensos.

 

Material y métodos

Diseñamos un estudio prospectivo observacional, iniciado en el año 2001. Se seleccionó de manera aleatoria una cohorte de personas sanas, con HTA como único factor de riesgo cardiovascular con el propósito de describir la incidencia de complicaciones a lo largo del tiempo. Los pacientes se encontraban en los estadios I ó II de hipertensión sistólica o diastólica, según los criterios de la VI Reunión del Joint National Committee (1997). Los criterios de exclusión fueron alcoholismo, presencia de neoplasias, hipertensión secundaria, insuficiencia renal crónica, hiper o hipocalcemia, diabetes, hiperparatiroidismo y empleo de fármacos que pudieran modificar la densidad mineral ósea (DMO). El promedio de duración de la hipertensión era de 7±8 años. Se siguieron un total de 71 pacientes hasta junio de 2014, realizando en ese momento un corte transversal en nuestro grupo para su estudio. Todos los pacientes firmaron un consentimiento informado y el estudio fue aprobado por el Comité de Investigación Clínica del Hospital Universitario Río Hortega.

Al inicio del estudio se realizó una analítica incluyendo calcio, fósforo y magnesio medidos mediante un autoanalizador Hitachi 917 (Tokio, Japón) y una densitometría de columna lumbar (L2-L4) realizada con un densitómetro Lunar (DEXA, Lunar Corporation, Madison, Wisconsin, EE.UU.). Posteriormente, la información sociodemográfica y clínica se obtuvo de la historia clínica digitalizada, recogiendo datos sobre tratamiento con diferentes antihipertensivos, desarrollo de enfermedades concomitantes e incidencia de fracturas patológicas osteoporóticas (radio distal, vértebra y cuello femoral) a lo largo del tiempo. Se valoró la comorbilidad mediante el Índice de Charlson (IC), en su versión original de 19 ítems, tal y como se ha descrito en la literatura [10].

El análisis del polimorfismo A986S se realizó con técnicas de biología molecular. El gen del CaSR se localiza en el cromosoma 3q21.1 y puede tener mutaciones inactivadoras o activadoras. El polimorfismo A986S se localiza en el exón 7 e implica un cambio entre alanina (A) y serina (S) en el extremo C-terminal intracelular del receptor que genera una pérdida de función de CaSR9. Para establecer el genotipo se obtuvo una muestra de sangre anticoagulada con EDTA y el ADN se extrajo mediante el kit QIAmp Blood (Qiagen, Hilden, Alemania). Diseñamos los primers para amplificar el exón 7 (primer directo 5'CTTTGATGAGCCTCAGAAGAGC3' y primer inverso 5'ACAACTCTTCAGGGTCCTCC3') y se modificó el primer directo introduciendo un cambio de base para así crear una secuencia palindrómica que nos permitiera reconocer cambios de nucleótidos mediante enzimas de restricción. La PCR se realizó empleando 25mM de cada dNTP (Applied Biosystems, Branchburg, New Jersey, EE.UU.), 50 mM de ClK, 10 mM de Tris HCl (ph 8.3), 1.5 U de la ADN polimerasa Amplitaq (Applied Biosystems, Foster City, California, EE.UU.), 2.5 m M de Cl2Mg y 20 pmol de cada primer, obteniendo así un volumen total de 40 μl. La PCR se llevó a cabo en un termociclador Perkin Elmer 9600 (Norwalk, Connecticut, EE.UU.) con sistema de control de temperatura. Los fragmentos se analizaron por electroforesis en gel de acrilamida al 8%. Tras la amplificación, las muestras fueron enfrentadas a los primers para crear los alelos específicos de restricción para la enzima BsaHI. Los fragmentos obtenidos fueron digeridos por BsaHI (New England Biolabs, Estocolmo, Suecia) y separados por electroforesis en gel de agarosa. La presencia del fragmento de restricción BsaHI representa A, mientras que la ausencia representa S, generando los genotipos AA, AS y SS.

Los datos se analizaron con el paquete estadístico SPSS v15.0 (SPSS Inc®) con nivel de significación para p≤0,05.

 

Resultados

Hasta el corte transversal de 2014 se han seguido un total de 71 pacientes, de los cuales 43,7% eran varones y 56,3% mujeres, con edad media 73,3±9 años, similar en ambos sexos (72,5±9 en hombres y 74±9 en mujeres: p=0,5). El 48% de nuestros pacientes tenía más de 75 años. El 17% de los pacientes fallecieron durante el seguimiento (todos en los 2 últimos años).

Basalmente no existían diferencias entre los dos grupos analizados (genotipo AA y genotipos AS+SS). Las cifras de tensión arterial sistólica (155±24 vs. 154±20 mmHg, p=0,841) y diastólica (106±33 vs. 93±11 mmHg, p=0,569) eran similares. No había diferencias en los niveles de calcio sérico (9,5±0,5 vs. 9,8±0,4 mg/dl, p=0,098) ni en la calciuria (219±124 vs. 275±175 mg/24h, p=0,268). La DMO en columna lumbar tampoco mostraba diferencias entre ambos grupos.

Al finalizar el seguimiento, la puntuación media en el IC fue de 1,7±2,7 (rango 0-12), siendo la comorbilidad alta en el 22,5% de los pacientes y no existiendo comorbilidad, según IC, en el 73,2% de nuestros pacientes. En cuanto a la aparición de otras enfermedades concomitantes, el 18,3% de los individuos era diabético, el 32,4% tenía factores de riesgo cardiovascular distintos de HTA, el 14% desarrolló cardiopatía isquémica, el 12,7% enfermedad cerebrovascular y el mismo porcentaje presentaba deterioro cognitivo en algún grado. Por otro lado, el 17% presentó al menos una fractura patológica osteoporótica (vertebral 8,5%, cuello femoral 5,6%, radio distal 2,8%).

El genotipo AA se encontró en el 67,6%, el SS en el 2,8% y el AS en el 29,6%, con frecuencia alélica A de 0,82 y S de 0,18, encontrándose en equilibrio Hardy-Weinberg (Χ2=0,03; p=0,8696 >0,05). Los individuos con genotipo AA, comparados con el resto de genotipos (AS+SS), no presentaban más factores de riesgo cardiovascular (29,2% vs. 39%, p=0,4), enfermedad cardiovascular (12,5% vs. 17,4%, p=0,5), presencia de comorbilidad según IC (27% vs. 26%, p=0,9), mayor mortalidad (18,8% vs. 13%, p=0,5) ni mayor número de fracturas patológicas globales (14,6% vs. 21,7%, p=0,4) ni específicas (vertebral 6,3% vs. 13%, p=0,3; cuello femoral 6,3% vs. 4,3%, p=0,6; radio distal 2,1% vs. 4,3%, p=0,5).

La edad media de las mujeres al inicio del estudio era de 59±9,9 años, todas postmenopáusicas, con índice de masa corporal de 28±4. La presión arterial sistólica media era de 155±22 mmHg y la diastólica de 93±10 mmHg. En el subgrupo de mujeres, aquéllas con genotipo AA presentaban más fracturas patológicas, especialmente en cuello femoral, sin asociación estadística (12% vs. 6,7%, p=0,5). Las características de los grupos en función del sexo y del genotipo se presentan en la tabla 1.

 

Discusión

La homeostasis del calcio juega un papel fundamental en el remodelado óseo, y las alteraciones de los mecanismos implicados en su regulación contribuyen al desarrollo de patología del metabolismo óseo [11]. El gen del CaSR es un gen candidato para determinar la susceptibilidad a la osteoporosis en la HTA, habiéndose relacionado el locus A986S del CaSR con el mantenimiento de la concentración de calcio iónico extracelular dentro de un estrecho rango [12] y con la calciuria. La mayor eliminación de calcio en los pacientes hipertensos se ha relacionado con un descenso de DMO y, por consiguiente, con un posible incremento del riesgo de fractura. Por otro lado, la HTA se ha asociado con niveles elevados de PTH, lo cual acelera el remodelado óseo, afectando tanto a la calidad como a la masa ósea [13].

Contrariamente a nuestras expectativas y en consonancia con diversos estudios [7,14], no hemos encontrado relación directa entre los genotipos del polimorfismo A986S y la incidencia de fracturas patológicas, sin hallar incremento del riesgo de fracturas patológicas en los pacientes portadores del alelo S. Nuestros datos concuerdan con un estudio previo publicado por nuestro grupo de investigación en el que en una población de mujeres hipertensas no encontramos diferencias en la calcemia, calciuria, niveles de PTHi y DMO en columna lumbar al categorizar según el genotipo AA y el genotipo AS+SS [15].

No existen muchos trabajos que evalúen la influencia del polimorfismo A986S en el riesgo de fracturas. Por una parte, diversos estudios realizados en población caucásica europea encuentran asociación sólo en población joven [6] pero no en mujeres postmenopáusicas ni en población hipertensa[11,15]. Sin embargo, existen datos contradictorios en la literatura y así, März et al. [16] sí establecen asociación entre el alelo S y los factores de riesgo cardiovascular. Cetani et al. [11] investigaron el efecto del polimorfismo sobre fracturas por fragilidad en un grupo de 164 mujeres postmenopáusicas, no encontrando diferencias. Bollerslev et al. [17] analizaron la asociación entre polimorfismo, masa ósea y fracturas en una cohorte de 1.252 mujeres postmenopáusicas, sin encontrar ninguna relación. Esta posible relación también se ha analizado en otras poblaciones y, así, Gianini et al. [18] estudiaron 87 mujeres sometidas a trasplante renal y con hiperparatiroidismo secundario persistente, encontrando resultados negativos similares a los de nuestro grupo. Recientemente, un grupo italiano ha estudiado factores de riesgo de fractura vertebral en una población con hiperparatiroidismo primario. Estudiaron 266 individuos (229 mujeres y 37 varones) con una distribución de genotipos similar a la nuestra. Encontraron que la presencia del alelo S (valorada como genotipo AS+SS) se asocia a un incremento del riesgo de fractura vertebral con una odds ratio de 1,8 (IC al 95%: 1,1-2,9, p=0,05) tras ajustar por edad, sexo, IMC, DMO y calcio sérico. Esta población es diferente de la nuestra siendo clave el papel de la PTH regulada por el receptor sensor del calcio [19].

La principal limitación de nuestro estudio es el tamaño muestral y la no recogida de fracturas morfométricas. Las fortalezas vienen determinadas por la homogeneidad de la población estudiada, el largo periodo de seguimiento y el emplear una variable objetiva como son las fracturas clínicas.

En conclusión, la asociación entre los genotipos del polimorfismo A986S del CaSR y la incidencia de fracturas patológicas es difícil de establecer y los diferentes estudios arrojan datos contradictorios contribuyendo a aumentar la confusión en este campo. En nuestro estudio, no hemos encontrado asociación entre polimorfismo A986S del CaSR y fracturas clínicas osteoporóticas, ni en la cohorte general ni en el subgrupo de mujeres, aunque la etiopatogenia de la osteoporosis en esta población hipertensa pueda venir determinada por los niveles de calcio sérico, la hipercalciuria y la posibilidad de un hiperparatiroidismo secundario.

 

Bibliografía

1. Yang S, Nguyen ND, Center JR, Eisman JA, Nguyen TV. Association between hypertension and fragility fracture: a longitudinal study. Osteoporos Int 2014;25:97-103.         [ Links ]

2. Perez-Castrillón JL, Martin-Escudero JC, Alvarez Manzanares P, Cortes Sancho R, Iglesias Zamora S, García Alonso M. Hypertension as a risk factor for hip fracture. Am J Hypertens 2005;18:146-7.         [ Links ]

3. Gadallah M, Massry SG, Bigazzi R, Horst RL, Eggena P, Campese VM. Intestinal absorption of calcium and calcium metabolism in patients with essential hypertension and normal renal function. Am J Hypertens 1991;4:404-9.         [ Links ]

4. Perez-Castrillon JL, Justo I, Silva J, Sanz A, Igea R, Escudero P, et al. Bone mass and bone modelling markers in hypertensive postmenopausal women. J Hum Hypertens 2003;17:107-10.         [ Links ]

5. Tsuda K, Nishio I, Masuyama Y. Bone mineral density in women with essential hypertension. Am J Hypertens 2001;14:704-7.         [ Links ]

6. Lorentzon M, Lorentzon R, Lerner UH, Nordstrom P. Calcium sensing receptor gene polymorphism, circulating calcium concentrations and bone mineral density in healthy adolescent girls. Eur J Endocrinol 2001;144:257-61.         [ Links ]

7. Pratt JH, Ambrosius WT, Wagner MA, Maharry K. Molecular variations in the calcium-sensing receptor in relation to sodium balance and presence of hypertension in blacks and whites. Am J Hypertens 2000;13:654-8.         [ Links ]

8. Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, et al. Cloning and characterization of an extracellular Ca(2+)-sensing receptor from bovine parathyroid. Nature 1993;366:575-80.         [ Links ]

9. Yun FH, Wong BY, Chase M, Shuen AY, Canaff L, Thongthai K, et al. Genetic variation at the calcium-sensing receptor (CASR) locus: implications for clinical molecular diagnostics. Clin Biochem 2007;40:551-61.         [ Links ]

10. Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method of classifying prognostic comorbidity in longitudinal studies: development and validation. J Chronic Dis 1987;40:373-83.         [ Links ]

11. Cetani F, Pardi E, Borsari S, Vignali E, Dipollina G, Braga V, et al. Calcium-sensing receptor gene polymorphism is not associated with bone mineral density in Italian postmenopausal women. Eur J Endocrinol 2003;148:603-7.         [ Links ]

12. Cole DE, Peltekova VD, Rubin LA, Hawker GA, Vieth R, Liew CC, et al. A986S polymorphism of the calcium-sensing receptor and circulating calcium concentrations. Lancet 1999;353:112-5.         [ Links ]

13. Cappuccio FP, Kalaitzidis R, Duneclift S, Eastwood JB. Unravelling the links between calcium excretion, salt intake, hypertension, kidney stones and bone metabolism. J Nephrol 2000;13:169-77.         [ Links ]

14. Blázquez JA, Navarro L, Andrés C, Ontañón J, Navarro A, del Pino J. Relación entre el polimorfismo A986S del CaSR y presión arterial en mujeres postmenopáusicas recientes. Rev Esp Enf Metab Óseas 2008;17:137.         [ Links ]

15. Pérez-Castrillón JL, Sanz A, Silva J, Justo I, Velasco E, Dueñas A. Calcium-sensing receptor gene A986S polymorphism and bone mass in hypertensive women. Arch Med Res 2006;37:607-11.         [ Links ]

16. März W, Seelhorst U, Wellnitz B, Tiran B, Obermayer-Pietsch B, Renner W, et al. Alanine to serine polymorphism at position 986 of the calcium-sensing receptor associated with coronary heart disease, myocardial infarction, all-cause, and cardiovascular mortality. J Clin Endocrinol Metab 2007;92:2363-9.         [ Links ]

17. Bollerslev J, Wilson SG, Dick IM, Devine A, Dhaliwal SS, Prince RL. Calcium-sensing receptor gene polymorphism A986S does not predict serum calcium level, bone mineral density, calcaneal ultrasound indices, or fracture rate in a large cohort of elderly women. Calcif Tissue Int 2004;74:12-7.         [ Links ]

18. Giannini S, Sella S, Silva Netto F, Cattelan C, Dalle Carbonare L, Lazzarin R, et al. Persistent secondary hyperparathyroidism and vertebral fractures in kidney transplantation: role of calcium-sensing receptor polymorphisms and vitamin D deficiency. J Bone Miner Res 2010;25:841-8.         [ Links ]

19. Eller-Vainicher C, Battista C, Guarnieri V, Muscarella S, Palmieri S, Salcuni AS, et al. Factors associated with vertebral fracture risk in patients with primary hyperparathyroidism. Eur J Endocrinol 2014;171:399-406.         [ Links ]

 

 

Dirección para correspondencia:
Laisa Socorro Briongos-Figuero
Servicio de Medicina Interna
Hospital Universitario del Río Hortega
c/Dulzaina, 2
47012 Valladolid (España)
Correo electrónico: laisadoc@hotmail.com

Fecha de recepción: 20/12/2014
Fecha de aceptación: 21/02/2015

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons